IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ chen-2020-16 in vitro In vitro fluorescence imaging fluorescence microscopy fluorescence imaging predetermined predetermined participant predetermined Chen H., Cui Y., Han X., Hu W., Sun M., Zhang Y., Wang PH., Song G., Chen W., Lou J. Virus - Publications including interactions involving viral proteins jlou@ibp.ac.cn,jackweichen@zju.edu.cn Cell research 2020 imex curation Coronavirus - Interactions investigated in the context of Coronavirus Only protein-protein interactions imex curation chen-2020-15 in vitro In vitro light microscopy light microscopy predetermined predetermined participant predetermined Chen H., Cui Y., Han X., Hu W., Sun M., Zhang Y., Wang PH., Song G., Chen W., Lou J. Virus - Publications including interactions involving viral proteins Differential interference contrast microscopy jlou@ibp.ac.cn,jackweichen@zju.edu.cn Cell research 2020 imex curation Coronavirus - Interactions investigated in the context of Coronavirus Only protein-protein interactions imex curation chen-2020-17 in vitro In vitro dls dynamic light scattering dls predetermined predetermined participant predetermined Chen H., Cui Y., Han X., Hu W., Sun M., Zhang Y., Wang PH., Song G., Chen W., Lou J. Virus - Publications including interactions involving viral proteins jlou@ibp.ac.cn,jackweichen@zju.edu.cn Cell research 2020 imex curation Coronavirus - Interactions investigated in the context of Coronavirus Only protein-protein interactions imex curation chen-2020-18 in vitro In vitro electron microscopy electron microscopy Electron crystallography Electron cryomicroscopy Electron crystallography Electron cryomicroscopy predetermined predetermined participant predetermined Chen H., Cui Y., Han X., Hu W., Sun M., Zhang Y., Wang PH., Song G., Chen W., Lou J. Virus - Publications including interactions involving viral proteins jlou@ibp.ac.cn,jackweichen@zju.edu.cn Cell research 2020 imex curation Coronavirus - Interactions investigated in the context of Coronavirus Only protein-protein interactions imex curation h20 h20 rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) AGAUUCAACUGGCAGUAACC ncap_sars2 Nucleoprotein N Nucleocapsid protein protein protein SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV MSDNGPQNQRNAPRITFGGPSDSTGSNQNGERSGARSKQRRPQGLPNNTASWFTALTQHGKEDLKFPRGQGVPINTNSSPDDQIGYYRRATRRIRGGDGKMKDLSPRWYFYYLGTGPEAGLPYGANKDGIIWVATEGALNTPKDHIGTRNPANNAAIVLQLPQGTTLPKGFYAEGSRGGSQASSRSSSRSRNSSRNSTPGSSRGTSPARMAGNGGDAALALLLLDRLNQLESKMSGKGQQQQGQTVTKKSAAEASKKPRQKRTATKAYNVTQAFGRRGPEQTQGNFGDQELIRQGTDYKHWPQIAQFAPSASAFFGMSRIGMEVTPSGTWLTYTGAIKLDDKDPNFKDQVILLNKHIDAYKTFPPTEPKKDKKKKADETQALPQRQKKQQTVTLLPAADLDDFSKQLQQSMSSADSTQA poly-u10 rna oligo poly-U10 RNA oligo rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) UUUUUUUUUU poly-u20 rna oligo poly-u20 rna oligo rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) UUUUUUUUUUUUUUUUUUUU poly-u40 rna oligo rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU poly-u60 rna oligo rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU a20 rna oligo A20 rna oligo rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) UAGCUUAUCAGACUGAUGUU a85 rna oligo a85 rna oligo rna ribonucleic acid RNA rna in vitro In vitro GGCGCAUAAAGAUGAGACGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGUUCG n1541 rna ribonucleic acid RNA rna in vitro In vitro GGGGAAUUGUGAGCGGAUAACAAUUCCCCUCUAGAAAUAAUUUUGUUUAACUUUAAGAAGGAGAUAUACCAUGGGCAGCAGCCAUCAUCAUCAUCAUCACCACCACCACCAUAGCAGCGGCCUGGUGCCGCGCGGCAGCGCUAGCAUGUCUGAUAAUGGACCCCAAAAUCAGCGAAAUGCACCCCGCAUUACGUUUGGUGGACCCUCAGAUUCAACUGGCAGUAACCAGAAUGGAGAACGCAGUGGGGCGCGAUCAAAACAACGUCGGCCCCAAGGUUUACCCAAUAAUACUGCGUCUUGGUUCACCGCUCUCACUCAACAUGGCAAGGAAGACCUUAAAUUCCCUCGAGGACAAGGCGUUCCAAUUAACACCAAUAGCAGUCCAGAUGACCAAAUUGGCUACUACCGAAGAGCUACCAGACGAAUUCGUGGUGGUGACGGUAAAAUGAAAGAUCUCAGUCCAAGAUGGUAUUUCUACUACCUAGGAACUGGGCCAGAAGCUGGACUUCCCUAUGGUGCUAACAAAGACGGCAUCAUAUGGGUUGCAACUGAGGGAGCCUUGAAUACACCAAAAGAUCACAUUGGCACCCGCAAUCCUGCUAACAAUGCUGCAAUCGUGCUACAACUUCCUCAAGGAACAACAUUGCCAAAAGGCUUCUACGCAGAAGGGAGCAGAGGCGGCAGUCAAGCCUCUUCUCGUUCCUCAUCACGUAGUCGCAACAGUUCAAGAAAUUCAACUCCAGGCAGCAGUAGGGGAACUUCUCCUGCUAGAAUGGCUGGCAAUGGCGGUGAUGCUGCUCUUGCUUUGCUGCUGCUUGACAGAUUGAACCAGCUUGAGAGCAAAAUGUCUGGUAAAGGCCAACAACAACAAGGCCAAACUGUCACUAAGAAAUCUGCUGCUGAGGCUUCUAAGAAGCCUCGGCAAAAACGUACUGCCACUAAAGCAUACAAUGUAACACAAGCUUUCGGCAGACGUGGUCCAGAACAAACCCAAGGAAAUUUUGGGGACCAGGAACUAAUCAGACAAGGAACUGAUUACAAACAUUGGCCGCAAAUUGCACAAUUUGCCCCCAGCGCUUCAGCGUUCUUCGGAAUGUCGCGCAUUGGCAUGGAAGUCACACCUUCGGGAACGUGGUUGACCUACACAGGUGCCAUCAAAUUGGAUGACAAAGAUCCAAAUUUCAAAGAUCAAGUCAUUUUGCUGAAUAAGCAUAUUGACGCAUACAAAACAUUCCCACCAACAGAGCCUAAAAAGGACAAAAAGAAGAAGGCUGAUGAAACUCAAGCCUUACCGCAGAGACAGAAGAAACAGCAAACUGUGACUCUUCUUCCUGCUGCAGAUUUGGAUGAUUUCUCCAAACAAUUGCAACAAUCCAUGAGCAGUGCUGACUCAACUCAGGCCUGUUGAGGAUCCUGUGAAUUCGAGCUCCGUCGACAAGCUUGCGGCCGCACUCGAGCACCACCACCACCACCACUGAGAUCCGGCUGCUAACAAAGCCCGAAAGGAAGCUGAGUUGGCUGCUGCCACCGCUGAGCAAUAA h20-n-2 3975684 N/A 3975688 unspecified role unspecified role neutral component neutral component region fluorescein fluorescein label fluorescein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false Alexa-647 alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false 1B-E, Supp. figure 3 B/C, 4A-D,6 divalent cations: Zn2+, Cu2+, Ni2+ LLPS (liquid–liquid phase separation) is dependent on ssRNA length. 647-N and H20 formed micrometer-sized droplets rapidly within minutes, and the small droplets further fused into larger ones. n-poly_u10 rna oligo-1 3975684 N/A 3975690 unspecified role unspecified role neutral component neutral component region fluorescein fluorescein label fluorescein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false C-terminus alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false 1C -U10, Supp. figure 5A N protein undergoes stronger LLPS (liquid–liquid phase separation) with longer RNAs; however the ability of N protein to undergo LLPS with short RNA is independent of short RNA sequence. n-poly_u20 rna oligo-2 3975684 N/A 3975691 unspecified role unspecified role neutral component neutral component region fluorescein fluorescein label fluorescein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false C-terminus alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false 1C -U20, Supp. figure 5A N protein undergoes stronger LLPS (liquid–liquid phase separation) with longer RNAs; however the ability of N protein to undergo LLPS with short RNA is independent of short RNA sequence. n-poly_u20 rna oligo-1 3975684 N/A 3975692 unspecified role unspecified role neutral component neutral component region fluorescein fluorescein label fluorescein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false C-terminus alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false 1C -U40, Supp. figure 5A N protein undergoes stronger LLPS (liquid–liquid phase separation) with longer RNAs; however the ability of N protein to undergo LLPS with short RNA is independent of short RNA sequence. n-poly_u40 rna oligo-1 3975684 N/A 3975693 unspecified role unspecified role neutral component neutral component region fluorescein fluorescein label fluorescein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false C-terminus alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false 1C -U60, Supp. figure 5A N protein undergoes stronger LLPS (liquid–liquid phase separation) with longer RNAs; however the ability of N protein to undergo LLPS with short RNA is independent of short RNA sequence. a20 rna oligo-n-1 3975684 N/A 3975694 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false C-terminus alexa 488 label alexa 488 label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Supp. figure S3A, 4E a20 rna oligo-n-2 3975684 N/A 3975688 competitor competitor competitor neutral component neutral component region fluorescein fluorescein label fluorescein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3975694 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false C-terminus alexa 488 label alexa 488 label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Supp. figure 4E When H20 was injected into the phase-separated solution that had already been formed by 488-N and A20, HEX fluorescence also appeared gradually inside the original droplets. h20-n-3 3975684 N/A 3975689 competitor competitor competitor neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false Alexa-488 alexa 488 label alexa 488 label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) N/A 3975688 unspecified role unspecified role neutral component neutral component region fluorescein fluorescein label fluorescein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false Alexa-647 alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Supp. figure 4D The fluorescence intensity of Alexa-488 in droplets increased gradually along with the decrease of Alexa-647 fluorescence intensity. a85 rna oligo-n-1 3975684 N/A 3975695 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false C-terminus alexa 488 label alexa 488 label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Supp. figure S5B a85 rna oligo-n-3 3975684 N/A 3975696 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false Alexa-657 alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Supp. figure S5C a20 rna oligo-n-3 3975684 N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false C-terminus alexa 488 label alexa 488 label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false C-terminus alexa 488 label alexa 488 label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Supp. figure 7A/B Zn2+ EDTA n-n-40 3975684 N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false Alexa-647 alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false Alexa-647 alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Supp. figure 7E Zn2+ h20-n-4 3975684 N/A 3975689 competitor competitor competitor neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false Alexa-488 alexa 488 label alexa 488 label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ctd binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 3975688 unspecified role unspecified role neutral component neutral component region fluorescein fluorescein label fluorescein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false Supp. figure 8 Zn2+: droplet formation could be enhanced by the addition of Zn2+ for all these N protein mutants, including even the NTD domain only mutant, which failed to form phase-separated droplets with H20 in the absence of Zn2+. h20-n-1 3975685 N/A 3975688 unspecified role unspecified role neutral component neutral component region fluorescein fluorescein label fluorescein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false C-terminus alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false 1B, Supp. figure 4 A/C,6 647-N and H20 formed micrometer-sized droplets rapidly within minutes, and the small droplets further fused into larger ones. divalent cations: Zn2+, Cu2+, Ni2+ a85 rna oligo-n-2 3975685 N/A 3975695 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false C-terminus alexa 488 label alexa 488 label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Supp. figure S5B n-n1541-1 3975685 N/A 3975696 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false Alexa-647 alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Supp. figure S5C n-n-39 3975685 N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false C-terminus alexa 488 label alexa 488 label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false C-terminus alexa 488 label alexa 488 label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Supp. figure 7A/B Zn2+ EDTA n-n-38 3975686 N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Supp. figure 2 E/F Authors do not specify if the N protein forms dimers or higher order aggregates n-n1541-2 3975687 N/A 3975696 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3975689 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain false C-terminus alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Supp. figure S7 C/D Zn2+