IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ jiang-2012-6 in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift antibody detection identification by antibody antibody detection Jiang YC., Wu HM., Cheng KH., Sunny Sun H. Ch-IP experiment (Fig 3d) was not captured as the primer sequences were not provided for HTR1A promoter. Also in this case we need to map a mutation - which is not possible as the promoter sequences are not available hssun@mail.ncku.edu.tw Human mutation 2012 Only protein-protein interactions imex curation imex curation jiang-2012-7 in vitro In vitro pull down pull down experimental particp experimental participant identification experimental particp Jiang YC., Wu HM., Cheng KH., Sunny Sun H. hssun@mail.ncku.edu.tw Human mutation 2012 Only protein-protein interactions imex curation imex curation jiang-2012-8 human-sh_sy5y Homo sapiens SH-SY5Y cell line sh_sy5y Human neuroblastoma cells ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Jiang YC., Wu HM., Cheng KH., Sunny Sun H. hssun@mail.ncku.edu.tw Human mutation 2012 Only protein-protein interactions imex curation imex curation htr1a-promoter_probe human htr1a promoter dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human GGCAGAAGAGAGAGAAGAGAGGAGGAGAGA chr5:63962185-63962214 parp1_human Poly [ADP-ribose] polymerase 1 PARP1 ADPRT PPOL NAD(+) ADP-ribosyltransferase 1 Poly[ADP-ribose] synthase 1 ADP-ribosyltransferase diphtheria toxin-like 1 DNA ADP-ribosyltransferase PARP1 Protein poly-ADP-ribosyltransferase PARP1 protein protein human Homo sapiens Human MAESSDKLYRVEYAKSGRASCKKCSESIPKDSLRMAIMVQSPMFDGKVPHWYHFSCFWKVGHSIRHPDVEVDGFSELRWDDQQKVKKTAEAGGVTGKGQDGIGSKAEKTLGDFAAEYAKSNRSTCKGCMEKIEKGQVRLSKKMVDPEKPQLGMIDRWYHPGCFVKNREELGFRPEYSASQLKGFSLLATEDKEALKKQLPGVKSEGKRKGDEVDGVDEVAKKKSKKEKDKDSKLEKALKAQNDLIWNIKDELKKVCSTNDLKELLIFNKQQVPSGESAILDRVADGMVFGALLPCEECSGQLVFKSDAYYCTGDVTAWTKCMVKTQTPNRKEWVTPKEFREISYLKKLKVKKQDRIFPPETSASVAATPPPSTASAPAAVNSSASADKPLSNMKILTLGKLSRNKDEVKAMIEKLGGKLTGTANKASLCISTKKEVEKMNKKMEEVKEANIRVVSEDFLQDVSASTKSLQELFLAHILSPWGAEVKAEPVEVVAPRGKSGAALSKKSKGQVKEEGINKSEKRMKLTLKGGAAVDPDSGLEHSAHVLEKGGKVFSATLGLVDIVKGTNSYYKLQLLEDDKENRYWIFRSWGRVGTVIGSNKLEQMPSKEDAIEHFMKLYEEKTGNAWHSKNFTKYPKKFYPLEIDYGQDEEAVKKLTVNPGTKSKLPKPVQDLIKMIFDVESMKKAMVEYEIDLQKMPLGKLSKRQIQAAYSILSEVQQAVSQGSSDSQILDLSNRFYTLIPHDFGMKKPPLLNNADSVQAKVEMLDNLLDIEVAYSLLRGGSDDSSKDPIDVNYEKLKTDIKVVDRDSEEAEIIRKYVKNTHATTHNAYDLEVIDIFKIEREGECQRYKPFKQLHNRRLLWHGSRTTNFAGILSQGLRIAPPEAPVTGYMFGKGIYFADMVSKSANYCHTSQGDPIGLILLGEVALGNMYELKHASHISKLPKGKHSVKGLGKTTPDPSANISLDGVDVPLGTGISSGVNDTSLLYNEYIVYDIAQVNLKYLLKLKFNFKTSLW htr1a_promoter-parp1-1 3595813 N/A 3595816 unspecified role unspecified role bait bait purified purified region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n.16delA NM_000524.3:c.-480delA mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) 5:63962214-63962185 N/A 3595817 unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep human-sh_sy5y Homo sapiens SH-SY5Y cell line sh_sy5y Human neuroblastoma cells physical association physical association false false false Figure 3c htr1a_promoter-parp1-2 3595814 N/A 3595816 unspecified role unspecified role bait bait purified purified region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n.16delA NM_000524.3:c.-480delA mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) 5:63962214-63962185 (chr5:63962185-63962214) N/A 3595817 weight silver stain molecular weight estimation by silver staining weight silver stain sequence tag sequence tag identification sequence tag western blot western blot Immuno blot Immuno blot unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep human-sh_sy5y Homo sapiens SH-SY5Y cell line sh_sy5y Human neuroblastoma cells physical association physical association false false false Figure 3a, 3b parp1-htr1a_promoter_probe-1 3595815 N/A 3595816 unspecified role unspecified role prey prey n.16delA mutation causing mutation causing an interaction mutation enabling interaction mutation causing mutation causing an interaction certain certain sequence position certain certain certain sequence position certain false chr5:63962185-63962214 N/A 3595817 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association false false false 3D ChIP assay was performed with transfected WT or Mutant HTR1A reporter construct. The Primers used are not specified and none in Table S2 cover the region in question (-just upstream from the Transcription start site) or the genomic location cannot be identified. The mutation is -480 residues from the Translation start site and -66 residues from the Transcription start site. (mutation is rs367956927 in Dbsnp)