IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ mwinyi-2010-1 in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Mwinyi J., Hofmann Y., Pedersen RS., Nekvindová J., Cavaco I., Mkrtchian S., Ingelman-Sundberg M. Jessica.Mwinyi@ki.se Life sciences 2010 Only protein-protein interactions imex curation imex curation mwinyi-2010-2 human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Mwinyi J., Hofmann Y., Pedersen RS., Nekvindová J., Cavaco I., Mkrtchian S., Ingelman-Sundberg M. Jessica.Mwinyi@ki.se Life sciences 2010 Only protein-protein interactions imex curation imex curation gata4_human Transcription factor GATA-4 GATA4 GATA-binding factor 4 protein protein human Homo sapiens Human MYQSLAMAANHGPPPGAYEAGGPGAFMHGAGAASSPVYVPTPRVPSSVLGLSYLQGGGAGSASGGASGGSSGGAASGAGPGTQQGSPGWSQAGADGAAYTPPPVSPRFSFPGTTGSLAAAAAAAAAREAAAYSSGGGAAGAGLAGREQYGRAGFAGSYSSPYPAYMADVGASWAAAAAASAGPFDSPVLHSLPGRANPAARHPNLDMFDDFSEGRECVNCGAMSTPLWRRDGTGHYLCNACGLYHKMNGINRPLIKPQRRLSASRRVGLSCANCQTTTTTLWRRNAEGEPVCNACGLYMKLHGVPRPLAMRKEGIQTRKRKPKNLNKSKTPAAPSGSESLPPASGASSNSSNATTSSSEEMRPIKTEPGLSSHYGHSSSVSQTFSVSAMSGHGPSIHPVLSALKLSPQGYASPVSQSPQTSSKQDSWNSLVLADSHGDIITA Defects in GATA4 are the cause of atrial septal defect type 2 (ASD2) [MIM:607941]. ASD2 is a congenital heart malformation characterized by incomplete closure of the wall between the atria resulting in blood flow from the left to the right atria. ASD2 patients show other heart abnormalities including ventricular and atrioventricular septal defects, pulmonary valve thickening or insufficiency of the cardiac valves. ASD2 is not associated with defects in the cardiac conduction system or non-cardiac abnormalities mint Transcriptional activator. Binds to the consensus sequence 5'-AGATAG-3'. Acts as a transcriptional activator of ANF in cooperation with NKX2-5 gata-4_binding_region human_gata-4_binding_region nucleic acid nucleic acid human Homo sapiens Human ATTTTATTTTTATCTCTATCAGTGGGTCAA gata6_human Transcription factor GATA-6 GATA6 GATA-binding factor 6 protein protein human Homo sapiens Human MALTDGGWCLPKRFGAAGADASDSRAFPAREPSTPPSPISSSSSSCSRGGERGPGGASNCGTPQLDTEAAAGPPARSLLLSSYASHPFGAPHGPSAPGVAGPGGNLSSWEDLLLFTDLDQAATASKLLWSSRGAKLSPFAPEQPEEMYQTLAALSSQGPAAYDGAPGGFVHSAAAAAAAAAAASSPVYVPTTRVGSMLPGLPYHLQGSGSGPANHAGGAGAHPGWPQASADSPPYGSGGGAAGGGAAGPGGAGSAAAHVSARFPYSPSPPMANGAAREPGGYAAAGSGGAGGVSGGGSSLAAMGGREPQYSSLSAARPLNGTYHHHHHHHHHHPSPYSPYVGAPLTPAWPAGPFETPVLHSLQSRAGAPLPVPRGPSADLLEDLSESRECVNCGSIQTPLWRRDGTGHYLCNACGLYSKMNGLSRPLIKPQKRVPSSRRLGLSCANCHTTTTTLWRRNAEGEPVCNACGLYMKLHGVPRPLAMKKEGIQTRKRKPKNINKSKTCSGNSNNSIPMTPTSTSSNSDDCSKNTSPTTQPTASGAGAPVMTGAGESTNPENSELKYSGQDGLYIGVSLASPAEVTSSVRPDSWCALALA cp2cj_human_gene Cytochrome P450 2C19 CYP2C19 gene gene human Homo sapiens Human gata_4_binding_region-gata4-1 3579574 N/A 3579576 unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep physiological level physiological level endogenous level endogenous endogenous endogenous level human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). N/A 3579577 unspecified role unspecified role bait bait purified purified n.12_14delinsTTT mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false n.18_20delinsTTT mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) 10:94762531-94762560 physical association physical association false false false Fig. 4a gata_4_binding_region-gata4-2 3579574 N/A 3579576 unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep physiological level physiological level endogenous level endogenous endogenous endogenous level human-huh7 Homo sapiens hepatoma cell line established from a hepatocellular carcinoma huh7 Human hepatoma cell line established from a hepatocellular carcinoma N/A 3579577 unspecified role unspecified role bait bait purified purified n.18_20delinsTTT mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false n.12_14delinsTTT mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) 10:94762531-94762560 physical association physical association false false false Fig. 4b gata_4_binding_region-gata4-3 3579574 N/A 3579578 unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep physiological level physiological level endogenous level endogenous endogenous endogenous level human-huh7 Homo sapiens hepatoma cell line established from a hepatocellular carcinoma huh7 Human hepatoma cell line established from a hepatocellular carcinoma N/A 3579577 unspecified role unspecified role bait bait purified purified chemical synthesis Chemical synthesis (Chemical synthesis) 10:94762531-94762560 physical association physical association false false false Fig. 4b cyp2c19-cyp2c19-1 3579575 N/A 3579576 unspecified role unspecified role bait bait subcellular prep subcellular preparation subcellular prep physiological level physiological level endogenous level endogenous endogenous endogenous level N/A 3579579 unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep physiological level physiological level endogenous level endogenous endogenous endogenous level region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Forward: 5′-TGAAACCAGAATGTACAGAGTGGG Reverse: 5′-AAGACAACCGTGAGCTTGCAC physical association physical association false false false Fig. 5