IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ bassi-2002-3 in vitro In vitro solution sedimentati cosedimentation in solution solution sedimentati predetermined predetermined participant predetermined Bassi GS., de Oliveira DM., White MF., Weeks KM. Reaction kinetics are most accurately followed using a 5′-32P-end-labeled RNA precursor and a pG nucleophile. To observe potentially inefficient self-splicing reactions, we also followed splicing by using the sensitive approach of detecting addition of [32P]-GTP to unlabeled RNA. weeks@unc.edu Proceedings of the National Academy of Sciences of the United States of America 2002 imex curation Only protein-protein interactions imex curation bassi-2002-2 in vitro In vitro filter binding filter binding Filter overlay assay Filter overlay assay predetermined predetermined participant predetermined Bassi GS., de Oliveira DM., White MF., Weeks KM. weeks@unc.edu Proceedings of the National Academy of Sciences of the United States of America 2002 imex curation Only protein-protein interactions imex curation bassi-2002-1 in vitro In vitro nuclease assay nuclease assay predetermined predetermined participant predetermined Bassi GS., de Oliveira DM., White MF., Weeks KM. Reaction kinetics are most accurately followed using a 5′-32P-end-labeled RNA precursor and a pG nucleophile. To observe potentially inefficient self-splicing reactions, we also followed splicing by using the sensitive approach of detecting addition of [32P]-GTP to unlabeled RNA. weeks@unc.edu Proceedings of the National Academy of Sciences of the United States of America 2002 imex curation Only protein-protein interactions imex curation mrs1_yeast Mitochondrial RNA-splicing protein MRS1 YIR021W MRS1 PET157 protein protein yeast Saccharomyces cerevisiae Baker's yeast MSPKNITRSVIPAIDLYCRKANFKTLKSLSMILGSKKEWYDTKKAPLRTFLVSRCGIFEQLRGRLVEDGKVNLFSVFLTNDSFSFCKMTVDDKFNTSLVDWQKIPFDSTFATDRRQNISLLPVDTLFATEKIISILGVSPNMTNLVSIERERSDLVDFNCKLQSNILEHLLYAKCQGVYVTSTNEKARLLAAVCNPEFIDTFWCELTPIRVSLKENPSISVPREYQMYDPVVRATIKEVVTKRLLRSAFDNDIDPLMCLHLDKGWKLKFPILSSTTGLNFSLKDCLSLDTGKDASDMTEVFLATMESSKVLRTYSNLVDIVMKDNGRLDSGVLKQFNDYVKQEKLNLQHFQAGSSKFLKGAKI mbi3_yeast Cytochrome b mRNA maturase bI3 BI3 Q0115 protein protein yeast Saccharomyces cerevisiae Baker's yeast MAFRKSNVYLSLVNSYIIDSPQPSSINYWWNMGSLLGLCLVIQIVTGIFMAMHYSSNIELAFSSVEHIMRDVHNGYILRYLHANGASFFFMVMFMHMAKGLYYGSYRSPRVTLWNVGVIIFILTIATAFLGYCCVYGQMSHWGATVITNLFSAIPFVGNDIVSWLWGGFNMEDPYYSNMMLNKSVLCWNIFIWMMNYYIIQLIIYNNMIWNKNNMVKMFIMRRKLAVINMYMYMKLIIQRTYSYYMNNTIIYDKNHKLNTDNPIYAYIGGLFEGDGWITISKKGKYLLYELGIEMHIRDIQLLYKIKNILGIGKVTIKKLKMKDGTIKEMCKFNVRNKNHLKNIIIPIFDKYPMLTNKHYDYLYFKDNLLKDIKYYNDLSYYLRPIKPFNTTEDILNKNYFSSWLIGFFEAESCFSIYKPMNKKMKTASFEVSQNNSMEVMLAIKSYLKITQNIYTDKFNNSRMTTKSINGIKNVVMFINNNPIKLLGYKKLQYLLFLKDLRTITKYNNYFKIPPKY bi3_intron_yeast_mrna bi3 intron mRNA mrna messenger rna mRNA mrna yeast Saccharomyces cerevisiae Baker's yeast UAAUAUAGAGGAUCCAUAUUAUAGUAAUAUAAUAUUAAAUAAAUCUGUUUUAUGCUGAAAUAUCUUCAUUUGAAUAAUAAAUUACUAUAUUAUUCAAUUAAUUAUUUAUAAUAAUAUAAUUUGAAAUAAAAAUAAUAUAGUUAAAAUAUUUAUUAUAAGAAGAAAAUUAGCAGUAAUUAAUAUAUAUAUAUAUAUAAAAUUAAUUAUUCAGAGACUUUAUAGUUAUUAUAUAAAUAAUACUAUUAUUUAUGAUAAAAAUCAUAAAUUAAACACAGAUAAUCCUAUUUAUGCAUAUAUUGGUGGUUUAUUUGAAGGAGAUGGUUGAAUUACUAUUUCAAAAAAAGGUAAAUAUUUAUUAUAUGAAUUAGGUAUUGAAAUACAUAUUAGAGAUAUUCAAUUAUUAUAUAAAAUUAAAAAUAUUUUAGGUAUUGGUAAAGUAACAAUUAAAAAAUUAAAAAUAAAAGAUGGUACUAUUAAAGAAAUAUGUAAAUUUAAUGUAAGAAAUAAAAAUCAUUUAAAGAAUAUUAUUAUUCCUAUUUUUGAUAAAUAUCCUAUAUUAACUAAUAAACAUUAUGAUUAUUUAUAUUUUAAAGAUAAUUUAUUAAAAGAUAUUAAAUAUUAUAAUGAUUUAUCUUAUUAUUUACGUCCUAUUAAACCAUUUAAUACUCUUGAAGAUAUUUUAAAUAAAAAUUAUUUUUCUUCAUGAUUAAUUGGUUUUUUUGAAGCUGAAAGUUGUUUUAGUAUUUAUAAACCUAUAAAUAAAAAAAUAAAACUUGCUAGUUUUGAAGUAUCUCAAAAUAAUAGUAUAGAAGUUAUAUUAGCUAUUAAAUCAUAUUUAAAAAUUACUCAAAAUAUUUAUACAGAUAAAUUUAAUAAUUCAAGAAUAACACUUAAAAGUAUUAAUGGUAUUAAAAAUGUUGUAAUAUUUAUUAAUAAUAACCCUAUUAAAUUAUUAGGUUAUAAAAAAUUACAAUAUUUAUUAUUCUUAAAAGAUUUACGUCUUAUUCUUAAAUAUAAUAAUUAUUUUAAAAUUCCUCCUAAAUAUUAAUCUUAUAUAAAAAUAUAAUAAUAAUAUAUUUAUAUAUUAUAUAAUUAUAUAAACAAAAUAUAAUUUAUAUAUAAUUAUUUAUUAUAAAUAUAGUCCGGCCCGCCCCGCGGGGCGGACCCCGGAGGAGUGAGGGACCCCUCCCUAUUCUAACGGGAGGGGGACCGAACCCCGAAGGAGUUUAAUUAUAUAUUAAAUAUAUUAUUAUCAAUAAAUAAUUCCUUUGAACUAUUUAUUAUUUUAUUAUAUUUAUUUUCUCCUUCAUUAUUAAUUUUUAUUAAUAAUUAAAAUCUUAUCAUUUUAUGGUAUUUUUAUUUCUAUUUUAGGAUAUCGAAACUAUAAAUUAAAAAGUAUAAUUUUAUUAAUUAUAAUUUAUGAUUAAUAAAUAAGAAAUAAAAACUUUAGAAGUAAUAUUUAUCUUUUUUUUUUAUAAAUAAAUAUUAUGAUUAAUAUAUAAUCAUUUAUAAAUAUUUAUAUAUAAUUAUAUAUAUACAUAAAUAGGAUUAAGAUAUAGUCCGAACAAUAUAGUGAUAUAUUGAUAAUAGUUUUCAAAUAUGUAACUAUUUAAACAUUAAAAG gmp GMP 5'-GMP GMP Guanosine 5'-monophosphate Guanosine 5'-phosphate Guanosine monophosphate guanosine-5'-monophosphate Guanylic acid pG 5'-guanylic acid [(2R,3S,4R,5R)-5-(2-amino-6-oxo-1,6-dihydro-9H-purin-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl]methyl dihydrogen phosphate small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) RQFCJASXJCIDSX-UUOKFMHZSA-N bi3-bi3_intron_yeast_mrna-4 3316385 N/A 3316388 unspecified role unspecified role neutral component neutral component n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) Stoichiometry: 4.0 N/A 3316389 unspecified role unspecified role neutral component neutral component ecoli Escherichia coli (strain K12) Stoichiometry: 1.0 N/A 3316390 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Stoichiometry: 1.0 physical association physical association false false false Fig. 4B, Table 1 An intron in which a 1,325-nucleotide loop in L8 is deleted is sufficient to bind Mol wt=420kDa bi3_intron_yeast_mrna-mrs1-2 3316385 N/A 3316388 unspecified role unspecified role neutral component neutral component n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) Stoichiometry: 4.0 N/A 3316390 unspecified role unspecified role neutral component neutral component bi3_intronic_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Stoichiometry: 1.0 direct interaction direct interaction false false false Table 1 An intron in which a 1,325-nucleotide loop in L8 is deleted is sufficient to bind Mol wt=372kDa mrs1-1 3316385 N/A 3316388 unspecified role unspecified role neutral component neutral component n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) Stoichiometry: 2.0 direct interaction direct interaction false false false Table 1 An intron in which a 1,325-nucleotide loop in L8 is deleted is sufficient to bind Mol wt=92kDa bi3-bi3_intron_yeast_mrna-5 3316385 N/A 3316389 unspecified role unspecified role neutral component neutral component ecoli Escherichia coli (strain K12) Stoichiometry: 1.0 N/A 3316390 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Stoichiometry: 1.0 physical association physical association false false false Table 1 An intron in which a 1,325-nucleotide loop in L8 is deleted is sufficient to bind Mol wt=220kDa bi3-bi3_intron_yeast_mrna-2 3316386 N/A 3316389 unspecified role unspecified role bait bait ecoli Escherichia coli (strain K12) Stoichiometry: 1.0 N/A 3316390 unspecified role unspecified role prey prey region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Stoichiometry: 1.0 direct interaction direct interaction false false false 3316386 Fig. 3B, 3C Interaction observed in presence of magnesium. bi3_intron_yeast_mrna-mrs1-1 3316386 N/A 3316388 unspecified role unspecified role prey prey n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) Stoichiometry: 2.0 N/A 3316390 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Stoichiometry: 1.0 direct interaction direct interaction false false false Fig. 3D MRS1 dimer binding to the bI3 intron is strongly cooperative under optimal splicing conditions (20 mM Mg2+). In the absence of Mg2+, binding is noncooperative. bi3_intron_yeast_mrna-mrs1-3 3316386 N/A 3316388 unspecified role unspecified role prey prey n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) Stoichiometry: 4.0 N/A 3316390 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Stoichiometry: 1.0 direct interaction direct interaction false false false Fig. 3E Stoichiometric binding assay bi3-bi3_intron_yeast_mrna-1 3316387 N/A 3316391 cofactor cofactor coenzyme unspecified role unspecified role N/A 3316388 unspecified role unspecified role neutral component neutral component n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3316389 unspecified role unspecified role unspecified role unspecified role ecoli Escherichia coli (strain K12) N/A 3316390 enzyme target enzyme target substrate substrate neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false rna cleavage rna cleavage false false false Fig. 2A, 2B, 3A An intron in which a 1,325-nucleotide loop in L8 is deleted is sufficient to bind The Km of the binding of GMP to the bI3 ribonucleoprotein ternary complex was measured as 180uM