IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ brow-1988-1 yeast Saccharomyces cerevisiae Baker's yeast comig non denat gel comigration in non denaturing gel electrophoresis comig non denat gel northern blot northern blot northen Brow DA., Guthrie C. Samples were incubated at increasing temperatures before migration to evaluate the melting temperature of the complex Nature 1988 imex curation Only protein-protein interactions imex curation snru6_yeast small nuclear RNA U6 Yeast snrna small nuclear rna snRNA snrna yeast Saccharomyces cerevisiae Baker's yeast GUUCGCGAAGUAACCCUUCGUGGACAUUUGGUCAAUUUGAAACAAUACAGAGAUGAUCAGCAGUUCCCCUGCAUAAGGAUGAACCGUUUUACAAAGAGAUUUAUUUCGUUUU snr14_u4_yeast SNR14 snrna small nuclear rna snRNA snrna yeast Saccharomyces cerevisiae Baker's yeast AUCCUUAUGCACGGGAAAUACGCAUAUCAGUGAGGAUUCGUCCGAGAUUGUGUUUUUGCUGGUUGAAAUUUAAUUAUAAACCAGACCGUCUCCUCAUGGUCAAUUCGGUGUUCGCUUUUGAAUACUUCAAGACUAUGUAGGGAAUUUUUGGAAUACCUUU u4/u6-1 1932971 N/A 1932972 unspecified role unspecified role neutral component neutral component N/A 1932973 unspecified role unspecified role neutral component neutral component physical association physical association false false false Fig 4