IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ behm_ansmant-2004-1 in vitro In vitro isomerase assay isomerase assay weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Behm-Ansmant I., Grosjean H., Massenet S., Motorin Y., Branlant C. To detect pseudouridines, the tRNA was digested with T2 Rnase and TLC fractionated, before autoradiography Yuri.Motorin@maem.uhp-nancy.fr The Journal of biological chemistry 2004 imex curation Only protein-protein interactions imex curation behm_ansmant-2004-2 in vitro In vitro isomerase assay isomerase assay rt-pcr reverse transcription pcr RT-PCR Behm-Ansmant I., Grosjean H., Massenet S., Motorin Y., Branlant C. To reveal the pseudourydilation, the RNA was incubated with CMCT followed by alkaline solution and rt-PCR. Yuri.Motorin@maem.uhp-nancy.fr The Journal of biological chemistry 2004 imex curation Only protein-protein interactions imex curation trna_asp_guc tRna Asp GUC trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast UCCGUGAUAGUUUAAUGGUCAGAAUGGGCGCUUGUCGCGUGCCAGAUCGGGGUUCAAUUCCCCGUCGCGGAG pus9_yeast tRNA pseudouridine(32) synthase, mitochondrial YDL036C D2743 PUS9 tRNA-uridine isomerase 9 tRNA pseudouridylate synthase 9 tRNA pseudouridine synthase 9 protein protein yeast Saccharomyces cerevisiae Baker's yeast MQRNNRLRNLFTVPVIMARQLKRNALSAGLAFAGNATSNEFDEHLQNEVEREREIQKKKKIKRTQSKKSPDLINKSTFQSRTIGSKKEKHRQLDPEYEIVIDGPLRKIKPYHFTYRTFCKERWRDKKLVDVFISEFRDRESEYYKRTIENGDVHINDETADLSTVIRNGDLITHQVHRHEPPVTSRPIKVIFEDDNIMVIDKPSGIPVHPTGRYRFNTITKMLQNNLGFVVNPCNRLDRLTSGLMFLAKTPKGADNIGDQLKAREVTKEYVAKVVGEFPETEVIVEKPLKLIEPRLALNAVCQMDEKGAKHAKTVFNRISYDGKTSIVKCKPLTGRSHQIRVHLQYLGHPIANDPIYSNDEVWGNNLGKGGQADFDIVITKLDEIGKRKPAKSWFHSNGGYGEVLRQEKCSICESDLYTDPGPNDLDLWLHAYLYESTETEEGTEKKKWCYKTEYPEWALRR rib2_yeast Bifunctional protein RIB2 RIB2 PUS8 YOL066C protein protein yeast Saccharomyces cerevisiae Baker's yeast MEDSNNEASDDFNNLLNKEIESAKEVKLRKFANRNNNRNENSSKVKDASGFRLRVIQTDGHKTKKTDPDYEVTIDGPLRKIEPYFFTYKTFCKERWRDRKLVDVFVSEFRDREPSYYSKTIAEGKVYLNDEPANLDTIIRDGDLITHKVHRHEPPVTSKPIDIVFEDEDILVIDKPSSIPVHPTGRYRFNTITKMLERQLGYSVHPCNRLDKPTSGLMFLAKTPLGADRMGDQMKAREVTKEYVARVKGEFPIGIVEVDKPVRSVNPKVALNAVCEMSDENAKHAKTVFQRVSYDGQTSIVKCKPLTGRTHQIRVHLQYLGFPIANDPIYSNPDIWGPDLGRGGLQNYDDIVLKLDAIGKTNPAESWIHPHSEGEYLLGRQCEECEAEMYTDPGTNDLDLWLHAFRYESLERNSDTQKPLWSYRTKYPEWALEPHRRYMEMAVKEAGKCGPTKTAFSVGAVLVHGTQVLATGYSRELPGNTHAEQCALIKYSQLHPNCPTIVPMGTVLYTTMEPCSFRLSGNEPCCDRILATQGAIGTVFVGVMEPDTFVKNNTSLNKLESHGVNYIQIPGYEEECTIIAFKGHDNSDDKA pus9-trna asp guc-1 1936484 N/A 1936486 enzyme target enzyme target substrate substrate neutral component neutral component Pseudourydine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain false UTP_label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro N/A 1936487 enzyme enzyme neutral component neutral component Q12069:p.Asp238Ala mutation disrupting mutation disrupting interaction mutation disrupting certain certain sequence position certain certain certain sequence position certain false n_terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) isomerase reaction isomerase reaction false false false Fig7 A,B,C rib2-trna asp guc-1 1936484 N/A 1936488 enzyme enzyme neutral component neutral component n_terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false Q12362:p.Asp211Ala mutation disrupting mutation disrupting interaction mutation disrupting certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 1936486 enzyme target enzyme target substrate substrate neutral component neutral component Pseudourydine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain false UTP_label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro isomerase reaction isomerase reaction false false false Fig7 A,D,E rib2-trna asp guc-2 1936485 N/A 1936488 enzyme enzyme neutral component neutral component n_terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 1936486 enzyme target enzyme target substrate substrate neutral component neutral component Pseudourydine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain false in vitro In vitro isomerase reaction isomerase reaction false false false Fig7 F