IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ xing-2002-1 in vitro In vitro enzymatic study enzymatic study weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Xing F., Martzen MR., Phizicky EM., Xing F., Martzen MR., Phizicky EM. To detect dihydrouridine, tRNA was treated with RNAseP, then resolved by TLC. DUS1 interactions have been shown to be cofactor (FAD/NADH/NADPH) dependant. eric_phizicky@urmc.rochester.edu RNA (New York, N.Y.) 2002 imex curation Only protein-protein interactions imex curation trna phe gaa precursor trna Phe GAA precursor trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GCGGACUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAAAAACUUCGGUCAAGUCAUCUGGAGGUCCUGUGUUCGAUCCACAGAGUUCGCA dus1_yeast tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)] DUS1 tRNA-dihydrouridine synthase 1 YML080W protein protein yeast Saccharomyces cerevisiae Baker's yeast MTEPALSSANNALMQKLTGRQLFDKIGRPTRIVAPMVDQSELAWRILSRRYGATLAYTPMLHAKLFATSKKYREDNWSSLDGSSVDRPLVVQFCANDPEYLLAAAKLVEDKCDAVDLNLGCPQGIAKKGHYGSFLMEEWDLIHNLINTLHKNLKVPVTAKIRIFDDCEKSLNYAKMVLDAGAQFLTVHGRVREQKGQKTGLANWETIKYLRDNLPKETVFFANGNILYPEDISRCMEHIGADAVMSAEGNLYNPGVFNVGQTKNKEKIFPRVDKIIREYFQIVKECQESKASKTAMKSHFFKILRPFLPHHTDIRSTLATMNAKATWEEWEEQVVKPVEKVVQEIFEQPDIAIKDEITIGEKQSWGGSYRTVPYWRCQPYFRPVNGITGDKRVMQGLIDESVNKKRKADVPLESADKKKDVKA trna tyr gua precursor tRNA Tyr GUA precursor trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast CUCUCGGUAGCCAAGUUGGUUUAAGGCGCAAGACUGUAAUUUAUCACUACGAAAUCUUGAGAUCGGGCGUUCGACUCGCCCCCGGGAGA dus2_yeast tRNA-dihydrouridine(20) synthase [NAD(P)+] SMM1 DUS2 Protein SMM1 tRNA-dihydrouridine synthase 2 N2065 YNR015W protein protein yeast Saccharomyces cerevisiae Baker's yeast MVTYAGKLVLAPMVRAGELPTRLMALAHGADLVWSPEIIDKKLIQCVRKENTALQTVDYVVPSKVQTRPETLVFRTYPKLESSKLIFQIGSASPALATQAALKVINDVSGIDINAGCPKHFSIHSGMGSALLRTPDTLCLILKELVKNVGNPHSKPISVKIRLLDTKQDTLQLVKRLCATGITNLTVHCRKTEMRNREQPITDYIAEIYEICQANNVSLIVNGAIRDRSHFHDLQANHWKNTNIGGMIAECAERDPTVFDHTSKPSEDGPSWVVACREFIQWATKFDNHIGNTKYMLSRIVPGKSVFFQYFARCKSPEEVSFVLKQLNDDGSAQTDPSEYLENCRAQEKALKNANAIAKQKRKQTDHIGSDTKKQKVVPLPTDI trna leu caa precursor tRNA Leu CAA precursor trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GGUUGUUUGGCCGAGCGGUCUAAGGCGCCUGAUUCAAGAAAUAUCUUGACCGCAGUGAACUGUGGGAAUACUCAGGUAUCGUAAGAUGCAAGAGUUCGAAUCUCUUAGCAACCA dus4_yeast tRNA-dihydrouridine(20a/20b) synthase [NAD(P)+] DUS4 tRNA-dihydrouridine synthase 4 L8084.2 YLR405W protein protein yeast Saccharomyces cerevisiae Baker's yeast MHTMHIPSGDVLIPKPKLITEETDPLHIIKTRQKTHGRPVTIAGPMVRYSKLPFRQLCREYNVDIVYSPMILAREYVRNEHARISDLSTNNEDTPLIVQVGVNNVADLLKFVEMVAPYCDGIGINCGCPIKEQIREGIGCALIYNSDLLCSMVHAVKDKYGDKLRIETKIRIHEALDETVELCRKLCDAGVDWITIHGRTRRTRSSQPANLDAIKYIIENISDKNVPVIANGDCFKLSDLERITKYTGAHGVMAVRGLLSNPALFAGYTTCPWGCIEKFCYWALEFGGLPFQLAQHHLYCMLENMELKKSLLKKMMNLKNYISLIDWFNKTFEFKRYGEDGFGMGVEIPYKANSCVQRSASVVERQE dus1-trna phe gaa precursor-2 1937043 N/A 1937044 enzyme target enzyme target substrate substrate neutral component neutral component uridine_label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Dihydrouridine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain false N/A 1937045 enzyme enzyme neutral component neutral component tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false yeast Saccharomyces cerevisiae Baker's yeast enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false Fig3C, Fig5A, 6 The enzyme was expressed in yeast and purified with contaminants. However the same experiment was performed with E.coli expressed protein, confirming its enzymatic activity dus1-trna phe gaa precursor-3 1937043 N/A 1937044 enzyme target enzyme target substrate substrate neutral component neutral component uridine_label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Dihydrouridine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 1937045 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false Table 2 The enzyme was expressed in yeast and purified with contaminants. However the same experiment was performed with E.coli expressed protein, confirming the enzymatic activity dus1-trna tyr gua precursor-1 1937043 N/A 1937046 enzyme target enzyme target substrate substrate neutral component neutral component uridine_label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Dihydrouridine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 1937045 enzyme enzyme neutral component neutral component tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false yeast Saccharomyces cerevisiae Baker's yeast enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false Fig5A smm1-trna tyr gua precursor-1 1937043 N/A 1937047 enzyme enzyme neutral component neutral component tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false yeast Saccharomyces cerevisiae Baker's yeast N/A 1937046 enzyme target enzyme target substrate substrate neutral component neutral component uridine_label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Dihydrouridine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false Fig5A smm1-trna leu caa precursor-1 1937043 N/A 1937048 enzyme target enzyme target substrate substrate neutral component neutral component Dihydrouridine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false uridine_label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 1937047 enzyme enzyme neutral component neutral component tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false yeast Saccharomyces cerevisiae Baker's yeast enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false Fig5A dus4-trna leu caa precursor-1 1937043 N/A 1937049 enzyme enzyme neutral component neutral component tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false yeast Saccharomyces cerevisiae Baker's yeast N/A 1937048 enzyme target enzyme target substrate substrate neutral component neutral component Dihydrouridine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false uridine_label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false Fig5A