IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ peng-2013-3 Transcription of the human microsomal epoxide hydrolase gene (EPHX1) is regulated by an HNF-4α/CAR/RXR/PSF complex. in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Peng H., Zhu Q.S., Zhong S., Levy D. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis RXR proteins were also detected as participants binding to the CAR-site DNA probe in this experiment; however, as the specificity of the antibody for a specific RXR isoform is not indicated, the exact identity of the RXR participant could not be established and hence it was not captured here. The origin of the rat CAR and mouse PXR expression constructs are based on PMID:12628309. The origin of the mouse SHP expression construct is based on PMID:24379397. The origin of the human PSF expression construct is based on PMID:11259580. dlevy@usc.edu Biochim. Biophys. Acta (0006-3002) 2013 Only protein-protein interactions imex curation IBD - Inflammatory bowel disease peng-2013-1 Transcription of the human microsomal epoxide hydrolase gene (EPHX1) is regulated by an HNF-4α/CAR/RXR/PSF complex. human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Peng H., Zhu Q.S., Zhong S., Levy D. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis The origin of the rat CAR and mouse PXR expression constructs are based on PMID:12628309. The origin of the mouse SHP expression construct is based on PMID:24379397. The origin of the human PSF expression construct is based on PMID:11259580. dlevy@usc.edu Biochim. Biophys. Acta (0006-3002) 2013 Only protein-protein interactions imex curation IBD - Inflammatory bowel disease peng-2013-2 Transcription of the human microsomal epoxide hydrolase gene (EPHX1) is regulated by an HNF-4α/CAR/RXR/PSF complex. human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Peng H., Zhu Q.S., Zhong S., Levy D. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis RXR proteins were also detected as participants of the interactions in this experiment; however, as the specificity of the antibody for a specific RXR isoform is not indicated, the exact identity of the RXR participant could not be established and hence it was not captured here. The origin of the rat CAR and mouse PXR expression constructs are based on PMID:12628309. The origin of the mouse SHP expression construct is based on PMID:24379397. The origin of the human PSF expression construct is based on PMID:11259580. dlevy@usc.edu Biochim. Biophys. Acta (0006-3002) 2013 Only protein-protein interactions imex curation IBD - Inflammatory bowel disease peng-2013-4 Transcription of the human microsomal epoxide hydrolase gene (EPHX1) is regulated by an HNF-4α/CAR/RXR/PSF complex. in vitro In vitro pull down pull down ms participant Identification by mass spectrometry ms participant Peng H., Zhu Q.S., Zhong S., Levy D. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis The origin of the rat CAR and mouse PXR expression constructs are based on PMID:12628309. The origin of the mouse SHP expression construct is based on PMID:24379397. The origin of the human PSF expression construct is based on PMID:11259580. dlevy@usc.edu Biochim. Biophys. Acta (0006-3002) 2013 Only protein-protein interactions imex curation IBD - Inflammatory bowel disease hnf4a_human Hepatocyte nuclear factor 4-alpha Transcription factor HNF-4 Nuclear receptor subfamily 2 group A member 1 Transcription factor 14 HNF4A HNF4 NR2A1 TCF14 protein protein human Homo sapiens Human MRLSKTLVDMDMADYSAALDPAYTTLEFENVQVLTMGNDTSPSEGTNLNAPNSLGVSALCAICGDRATGKHYGASSCDGCKGFFRRSVRKNHMYSCRFSRQCVVDKDKRNQCRYCRLKKCFRAGMKKEAVQNERDRISTRRSSYEDSSLPSINALLQAEVLSRQITSPVSGINGDIRAKKIASIADVCESMKEQLLVLVEWAKYIPAFCELPLDDQVALLRAHAGEHLLLGATKRSMVFKDVLLLGNDYIVPRHCPELAEMSRVSIRILDELVLPFQELQIDDNEYAYLKAIIFFDPDAKGLSDPGKIKRLRSQVQVSLEDYINDRQYDSRGRFGELLLLLPTLQSITWQMIEQIQFIKLFGMAKIDNLLQEMLLGGSPSDAPHAHHPLHPHLMQEHMGTNVIVANTMPTHLSNGQMCEWPRPRGQAATPETPQPSPPGGSGSEPYKLLPGAVATIVKPLSAIPQPTITKQEVI hyep_human_hnf4a-site_dna-probe Human HYEP gene promoter HNF4a binding site DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human AGTTTGCTGTGCAGAGTCCAGGGGA nr1i3_human Nuclear receptor subfamily 1 group I member 3 NR1I3 CAR Constitutive androstane receptor Constitutive activator of retinoid response Orphan nuclear receptor MB67 protein protein human Homo sapiens Human MASREDELRNCVVCGDQATGYHFNALTCEGCKGFFRRTVSKSIGPTCPFAGSCEVSKTQRRHCPACRLQKCLDAGMRKDMILSAEALALRRAKQAQRRAQQTPVQLSKEQEELIRTLLGAHTRHMGTMFEQFVQFRPPAHLFIHHQPLPTLAPVLPLVTHFADINTFMVLQVIKFTKDLPVFRSLPIEDQISLLKGAAVEICHIVLNTTFCLQTQNFLCGPLRYTIEDGARVSPTVGFQVEFLELLFHFHGTLRKLQLQEPEYVLLAAMALFSPDRPGVTQRDEIDQLQEEMALTLQSYIKGQQRRPRDRFLYAKLLGLLAELRSINEAYGYQIQHIQGLSAMMPLLQEICS hyep_human_car-site_dna-probe Human HYEP gene promoter CAR binding site DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human TGTCTCAGGTCAGCGTGGTTCAGTTTG hyep_human_gene Epoxide hydrolase 1 (EPHX1) human gene gene gene human Homo sapiens Human sfpq_human Splicing factor, proline- and glutamine-rich SFPQ PSF Polypyrimidine tract-binding protein-associated-splicing factor DNA-binding p52/p100 complex, 100 kDa subunit 100 kDa DNA-pairing protein protein protein human Homo sapiens Human MSRDRFRSRGGGGGGFHRRGGGGGRGGLHDFRSPPPGMGLNQNRGPMGPGPGQSGPKPPIPPPPPHQQQQQPPPQQPPPQQPPPHQPPPHPQPHQQQQPPPPPQDSSKPVVAQGPGPAPGVGSAPPASSSAPPATPPTSGAPPGSGPGPTPTPPPAVTSAPPGAPPPTPPSSGVPTTPPQAGGPPPPPAAVPGPGPGPKQGPGPGGPKGGKMPGGPKPGGGPGLSTPGGHPKPPHRGGGEPRGGRQHHPPYHQQHHQGPPPGGPGGRSEEKISDSEGFKANLSLLRRPGEKTYTQRCRLFVGNLPADITEDEFKRLFAKYGEPGEVFINKGKGFGFIKLESRALAEIAKAELDDTPMRGRQLRVRFATHAAALSVRNLSPYVSNELLEEAFSQFGPIERAVVIVDDRGRSTGKGIVEFASKPAARKAFERCSEGVFLLTTTPRPVIVEPLEQLDDEDGLPEKLAQKNPMYQKERETPPRFAQHGTFEYEYSQRWKSLDEMEKQQREQVEKNMKDAKDKLESEMEDAYHEHQANLLRQDLMRRQEELRRMEELHNQEMQKRKEMQLRQEEERRRREEEMMIRQREMEEQMRRQREESYSRMGYMDPRERDMRMGGGGAMNMGDPYGSGGQKFPPLGGGGGIGYEANPGVPPATMSGSMMGSDMRTERFGQGGAGPVGGQGPRGMGPGTPAGYGRGREEYEGPNKKPRF rxra_human Retinoic acid receptor RXR-alpha RXRA NR2B1 Retinoid X receptor alpha Nuclear receptor subfamily 2 group B member 1 protein protein human Homo sapiens Human MDTKHFLPLDFSTQVNSSLTSPTGRGSMAAPSLHPSLGPGIGSPGQLHSPISTLSSPINGMGPPFSVISSPMGPHSMSVPTTPTLGFSTGSPQLSSPMNPVSSSEDIKPPLGLNGVLKVPAHPSGNMASFTKHICAICGDRSSGKHYGVYSCEGCKGFFKRTVRKDLTYTCRDNKDCLIDKRQRNRCQYCRYQKCLAMGMKREAVQEERQRGKDRNENEVESTSSANEDMPVERILEAELAVEPKTETYVEANMGLNPSSPNDPVTNICQAADKQLFTLVEWAKRIPHFSELPLDDQVILLRAGWNELLIASFSHRSIAVKDGILLATGLHVHRNSAHSAGVGAIFDRVLTELVSKMRDMQMDKTELGCLRAIVLFNPDSKGLSNPAEVEALREKVYASLEAYCKHKYPEQPGRFAKLLLRLPALRSIGLKCLEHLFFFKLIGDTPIDTFLMEMLEAPHQMT hyep_human_car+hnf4a-site_dna-probe Human HYEP gene promoter CAR and HNF4A binding site DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human TCTCAGGTCAGCGTGGTTCAGTTTGCTGTGCAGAGTCCAGGGGA hyep-hnf4a 1763398 n/a 1763402 unspecified role unspecified role prey prey human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). n/a 1763403 unspecified role unspecified role bait bait dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false c12a_g14t_a15t_g16c mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig. 1f hyep-hnf4a-1 1763398 n/a 1763403 unspecified role unspecified role bait bait dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1763402 unspecified role unspecified role prey prey human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). n/a 1763403 competitor competitor competitor prey prey c12a_g14t_a15t_g16c mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) association association false false false Fig. 1f hyep-nr1i3 1763398 n/a 1763404 unspecified role unspecified role prey prey human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). n/a 1763405 unspecified role unspecified role bait bait dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false g8c_g9t_t10g mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig. 3f Q14994 increases expression at RNA level of ENSG00000143819 hyep-nr1i3-1 1763398 n/a 1763404 unspecified role unspecified role prey prey human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). n/a 1763405 unspecified role unspecified role bait bait dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1763405 competitor competitor competitor ancillary ancillary g8c_g9t_t10g mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) association association false false false Fig. 3f Competition was seen to the middle and upper bands of the complex but not the lower band. hnf4a-hyep 1763399 n/a 1763406 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1763402 unspecified role unspecified role bait bait association association false false false Fig. 5b P41235 increases expression at RNA level of ENSG00000143819 sfpq-hyep 1763399 n/a 1763406 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1763407 unspecified role unspecified role bait bait association association false false false Fig. 5b P23246 decreases expression at RNA level of ENSG00000143819 rxra-hyep 1763399 n/a 1763408 unspecified role unspecified role bait bait n/a 1763406 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false Fig. 5b sfpq-hnf4a 1763400 n/a 1763407 unspecified role unspecified role bait bait n/a 1763402 unspecified role unspecified role prey prey physical association physical association false false false Fig. 5a hnf4a-rxra 1763400 n/a 1763407 unspecified role unspecified role prey prey n/a 1763402 unspecified role unspecified role bait bait physical association physical association false false false Fig. 5a hyep-sfpq 1763401 n/a 1763409 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1763407 unspecified role unspecified role prey prey human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). physical association physical association false false false none