bhf-ucl maida-2009-6 An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. anti bait coip anti bait coimmunoprecipitation anti bait coip northern blot northern blot northen Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins William_Hahn@dfci.harvard.edu Nature (0028-0836) 2009 Only protein-protein interactions imex curation maida-2009-1 An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. human-hela Homo sapiens epitheloid cervix carcinoma cells Human hela Human epitheloid cervix carcinoma HeLa cells derivation: cervix; epithelial; adenocarcinoma ATCC no:CCL-2 anti tag coip anti tag coimmunoprecipitation anti tag coip nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins William_Hahn@dfci.harvard.edu Nature (0028-0836) 2009 Only protein-protein interactions imex curation maida-2009-2 An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. human-hela Homo sapiens epitheloid cervix carcinoma cells Human hela Human epitheloid cervix carcinoma HeLa cells derivation: cervix; epithelial; adenocarcinoma ATCC no:CCL-2 anti tag coip anti tag coimmunoprecipitation anti tag coip rt-pcr reverse transcription pcr RT-PCR Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins William_Hahn@dfci.harvard.edu Nature (0028-0836) 2009 Only protein-protein interactions imex curation maida-2009-3 An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. human-hela Homo sapiens epitheloid cervix carcinoma cells Human hela Human epitheloid cervix carcinoma HeLa cells derivation: cervix; epithelial; adenocarcinoma ATCC no:CCL-2 anti bait coip anti bait coimmunoprecipitation anti bait coip rt-pcr reverse transcription pcr RT-PCR Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins William_Hahn@dfci.harvard.edu Nature (0028-0836) 2009 Only protein-protein interactions imex curation maida-2009-4 An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. anti bait coip anti bait coimmunoprecipitation anti bait coip rt-pcr reverse transcription pcr RT-PCR Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins William_Hahn@dfci.harvard.edu Nature (0028-0836) 2009 Only protein-protein interactions imex curation maida-2009-5 An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. anti tag coip anti tag coimmunoprecipitation anti tag coip rt-pcr reverse transcription pcr RT-PCR Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins William_Hahn@dfci.harvard.edu Nature (0028-0836) 2009 Only protein-protein interactions imex curation maida-2009-7 An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. human-hela Homo sapiens epitheloid cervix carcinoma cells Human hela Human epitheloid cervix carcinoma HeLa cells derivation: cervix; epithelial; adenocarcinoma ATCC no:CCL-2 anti tag coip anti tag coimmunoprecipitation anti tag coip northern blot northern blot northen Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins William_Hahn@dfci.harvard.edu Nature (0028-0836) 2009 Only protein-protein interactions imex curation maida-2009-8 An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. human-hela Homo sapiens epitheloid cervix carcinoma cells Human hela Human epitheloid cervix carcinoma HeLa cells derivation: cervix; epithelial; adenocarcinoma ATCC no:CCL-2 anti bait coip anti bait coimmunoprecipitation anti bait coip northern blot northern blot northen Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins William_Hahn@dfci.harvard.edu Nature (0028-0836) 2009 Only protein-protein interactions imex curation terc_human_rna Human telomerase RNA rna ribonucleic acid RNA rna human Homo sapiens Human GGGUUGCGGAGGGUGGGCCUGGGAGGGGUGGUGGCCAUUUUUUGUCUAACCCUAACUGAGAAGGGCGUAGGCGCCGUGCUUUUGCUCCCCGCGCGCUGUUUUUCUCGCUGACUUUCAGCGGGCGGAAAAGCCUCGGCCUGCCGCCUUCCACCGUUCAUUCUAGAGCAAACAAAAAAUGUCAGCUGCUGGCCCGUUCGCCCCUCCCGGGGACCUGCGGCGGGUCGCCUGCCCAGCCCCCGAACCCCGCCUGGAGGCCGCGGUCGGCCCGGGGCUUCUCCGGAGGCACCCACUGCCACCGCGAAGAGUUGGGCUCUGUCAGCCGCGGGUCUCUCGGGGGCGAGGGCGAGGUUCAGGCCUUUCAGGCCGCAGGAAGAGGAACGGAGCGAGUCCCCGCGCGCGGCGCGAUUCCCUGAGCUGUGGGACGUGCACCCAGGACUCGGCUCACACAUGC tert_human Telomerase reverse transcriptase TERT EST2 TCS1 TRT Telomerase catalytic subunit HEST2 Telomerase-associated protein 2 protein protein human Homo sapiens Human MPRAPRCRAVRSLLRSHYREVLPLATFVRRLGPQGWRLVQRGDPAAFRALVAQCLVCVPWDARPPPAAPSFRQVSCLKELVARVLQRLCERGAKNVLAFGFALLDGARGGPPEAFTTSVRSYLPNTVTDALRGSGAWGLLLRRVGDDVLVHLLARCALFVLVAPSCAYQVCGPPLYQLGAATQARPPPHASGPRRRLGCERAWNHSVREAGVPLGLPAPGARRRGGSASRSLPLPKRPRRGAAPEPERTPVGQGSWAHPGRTRGPSDRGFCVVSPARPAEEATSLEGALSGTRHSHPSVGRQHHAGPPSTSRPPRPWDTPCPPVYAETKHFLYSSGDKEQLRPSFLLSSLRPSLTGARRLVETIFLGSRPWMPGTPRRLPRLPQRYWQMRPLFLELLGNHAQCPYGVLLKTHCPLRAAVTPAAGVCAREKPQGSVAAPEEEDTDPRRLVQLLRQHSSPWQVYGFVRACLRRLVPPGLWGSRHNERRFLRNTKKFISLGKHAKLSLQELTWKMSVRDCAWLRRSPGVGCVPAAEHRLREEILAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVDVTGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILD rmrp_human_rna RNA component of mitochondrial RNA processing endoribonuclease snorna small nucleolar rna snoRNA snorna human Homo sapiens Human GGTTCGTGCTGAAGGCCTGTATCCTAGGCTACACACTGAGGACTCTGTTCCTCCCCTTTCCGCCTAGGGGAAAGTCCCCGGACCTCGGGCAGAGAGTGCCACGTGCATACGCACGTAGACATTCCCCGCTTCCCACTCCAAAGTCCGCCAAGAAGCGTATCCCGCTGAGCGGCGTGGCGCGGGGGCGTCATCCGTCAGCTCCCTCTAGTTACGCAGGCAGTGCGTGTCCGCGCACCAACCACACGGGGCTCATTCTCAGCGCGGCTGT ago2_human Protein argonaute-2 AGO2 Argonaute RISC catalytic component 2 EIF2C2 Eukaryotic translation initiation factor 2C 2 PAZ Piwi domain protein Protein slicer protein protein human Homo sapiens Human MYSGAGPALAPPAPPPPIQGYAFKPPPRPDFGTSGRTIKLQANFFEMDIPKIDIYHYELDIKPEKCPRRVNREIVEHMVQHFKTQIFGDRKPVFDGRKNLYTAMPLPIGRDKVELEVTLPGEGKDRIFKVSIKWVSCVSLQALHDALSGRLPSVPFETIQALDVVMRHLPSMRYTPVGRSFFTASEGCSNPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFVCEVLDFKSIEEQQKPLTDSQRVKFTKEIKGLKVEITHCGQMKRKYRVCNVTRRPASHQTFPLQQESGQTVECTVAQYFKDRHKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLMRSASFNTDPYVREFGIMVKDEMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTEVHLKSFTEQLRKISRDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPNRYCATVRVQQHRQEIIQDLAAMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFQQVLHHELLAIREACIKLEKDYQPGITFIVVQKRHHTRLFCTDKNERVGKSGNIPAGTTVDTKITHPTEFDFYLCSHAGIQGTSRPSHYHVLWDDNRFSSDELQILTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHTSGQSNGRDHQALAKAVQVHQDTLRTMYFA mttd_human_trna Mitochondrially encoded tRNA aspartic acid trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna human Homo sapiens Human AGGTATTAGAAAAACCATTTCATAACTTTGTCAAAGTTAAATTATAGGCTAAATCCTATATATCTTA mttv_human_trna mitochondrially encoded tRNA valine trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna human Homo sapiens Human CAGAGTGTAGCTTAACACAAAGCACCCAACTTACACTTAGGAGATTTCAACTTAACTTGACCGCTCTGA mttq_human_trna mitochondrially encoded tRNA glutamine trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna human Homo sapiens Human TAGGATGGGGTGTGATAGGTGGCACGGAGAATTTTGGATTCTCAGGGATGGGTTCGATTCTCATAGTCCTAG mttp_human_trna mitochondrially encoded tRNA proline trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna human Homo sapiens Human CAGAGAATAGTTTAAATTAGAATCTTAGCTTTGGGTGCTAATGGTGGAGTTAAAGACTTTTTCTCTGA mttg_human_trna mitochondrially encoded tRNA glycine trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna human Homo sapiens Human ACTCTTTTAGTATAAATAGTACCGTTAACTTCCAATTAACTAGTTTTGACAACATTCAAAAAAGAGTA mttr_human_trna mitochondrially encoded tRNA arginine trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna human Homo sapiens Human TGGTATATAGTTTAAACAAAACGAATGATTTCGACTCATTAAATTATGATAATCATATTTACCAA tert-rmrp-5 1575774 n/a 1575782 northern blot northern blot northen unspecified role unspecified role prey prey n/a 1575783 unspecified role unspecified role bait bait n/a 1575784 northern blot northern blot northen unspecified role unspecified role prey prey association association false false false Fig 1C lane 3 tert-rmrp-7 1575774 n/a 1575785 unspecified role unspecified role bait bait n/a 1575784 northern blot northern blot northen unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false association association false false false Fig 5C lane 5 miR-16 was also observed as an interactor prey as well as rmrp, however it is not clear which miR-16 as there are 2 genes in human tert-mttd-1 1575775 n/a 1575783 unspecified role unspecified role bait bait region tap tagged calmodulin binding peptide plus protein a tag CBP-ProtA tagged CBP-ProtA tagged tap tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1575782 nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence unspecified role unspecified role prey prey n/a 1575786 nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence unspecified role unspecified role prey prey n/a 1575784 nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence unspecified role unspecified role prey prey n/a mt-tRNA Val 1575787 nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence unspecified role unspecified role prey prey n/a 1575788 nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence unspecified role unspecified role prey prey n/a 1575789 nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence unspecified role unspecified role prey prey n/a mt-tRNA gly 1575790 nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence unspecified role unspecified role prey prey n/a mt-tRNA arg 1575791 nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence unspecified role unspecified role prey prey association association false false false Fig S2, Table S1 tert-rmrp-4 1575776 n/a 1575782 rt-pcr reverse transcription pcr RT-PCR unspecified role unspecified role prey prey n/a 1575783 unspecified role unspecified role bait bait region tap tagged calmodulin binding peptide plus protein a tag CBP-ProtA tagged CBP-ProtA tagged tap tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1575784 rt-pcr reverse transcription pcr RT-PCR unspecified role unspecified role prey prey association association false false false Fig 1a tert-rmrp-1 1575777 n/a 1575782 rt-pcr reverse transcription pcr RT-PCR unspecified role unspecified role prey prey n/a 1575783 unspecified role unspecified role bait bait n/a 1575784 rt-pcr reverse transcription pcr RT-PCR unspecified role unspecified role prey prey association association false false false Fig 1b lower panel tert-rmrp-2 1575778 n/a 1575782 rt-pcr reverse transcription pcr RT-PCR unspecified role unspecified role prey prey n/a 1575783 unspecified role unspecified role bait bait n/a 1575784 rt-pcr reverse transcription pcr RT-PCR unspecified role unspecified role prey prey association association false false false Fig 1b upper panel tert-rmrp-3 1575779 n/a 1575783 unspecified role unspecified role bait bait region required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain false n-terminal flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1575784 rt-pcr reverse transcription pcr RT-PCR unspecified role unspecified role prey prey physical association physical association false false false Fig S4b tert-rmrp-6 1575780 n/a 1575782 northern blot northern blot northen unspecified role unspecified role prey prey n/a 1575783 unspecified role unspecified role bait bait region tap tagged calmodulin binding peptide plus protein a tag CBP-ProtA tagged CBP-ProtA tagged tap tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1575784 northern blot northern blot northen unspecified role unspecified role prey prey association association false false false Fig 1C lane 1 tert-rmrp-8 1575781 n/a 1575785 unspecified role unspecified role bait bait n/a 1575784 northern blot northern blot northen unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false association association false false false Fig 5C lane 3 miR-16 was also observed as an interactor prey as well as rmrp, however it is not clear which miR-16 as there are 2 genes in human