IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ thibault-2009-1 Anti-activator ExsD forms a 1:1 complex with ExsA to inhibit transcription of type III secretion operons. in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa autoradiography autoradiography Thibault J., Faudry E., Ebel C., Attree I., Elsen S. sylvie.elsen@cea.fr J. Biol. Chem. (0021-9258) 2009 Only protein-protein interactions imex curation thibault-2009-3 Anti-activator ExsD forms a 1:1 complex with ExsA to inhibit transcription of type III secretion operons. in vitro In vitro molecular sieving molecular sieving Gel Filtration Size Exclusion Chromatography Size Exclusion Chromatography Gel Filtration Sizing column weight by comassie molecular weight estimation by coomasie staining weight by comassie Thibault J., Faudry E., Ebel C., Attree I., Elsen S. sylvie.elsen@cea.fr J. Biol. Chem. (0021-9258) 2009 Only protein-protein interactions imex curation thibault-2009-2 Anti-activator ExsD forms a 1:1 complex with ExsA to inhibit transcription of type III secretion operons. in vitro In vitro molecular sieving molecular sieving Gel Filtration Size Exclusion Chromatography Size Exclusion Chromatography Gel Filtration Sizing column anti tag western anti tag western blot anti tag western Thibault J., Faudry E., Ebel C., Attree I., Elsen S. sylvie.elsen@cea.fr J. Biol. Chem. (0021-9258) 2009 Only protein-protein interactions imex curation j7dcm5_pseai exsA PACIG1_3608 protein protein pseudomonas aeruginosa cig1 Pseudomonas aeruginosa CIG1 MQGAKSLGRKQITSCHWNIPTFEYRVNKEEGVYVLLEGELTVQDIDSTFCLAPGELLFVRRGSYVVSTKGKDSRILWIPLSAQFLQGFVQRFGALLSEVERCDEPVPGIIAFAATPLLAGCVKGLKELLVHEHPPMLACLKIEELLMLFAFSPQGPLLMSVLRQLSNRHVERLQLFMEKHYLNEWKLSDFSREFGMGLTTFKELFGSVYGVSPRAWISERRILYAHQLLLNSDMSIVDIAMEAGFSSQSYFTQSYRRRFGCTPSRSRQGKDECRAKNN The sequence has been withdrawn from uniprot. p95429_pseai exsD E4V10_00450 PAMH19_5053 ECC04_020105 IPC1316_11625 IPC1339_18030 IPC614_16225 IPC1295_05320 IPC1323_11550 protein protein pseai Pseudomonas aeruginosa MEQEDDKQYSREAVFAGRRVSVVGSDARSRGRVPGYASSSLYRESGIISARQLALLQRMLPRLRLEQLFRCEWLQQRLARGLALGREEVRQILLCAAQDDDGWCAELGDRVNLAVPQSMIDWVLLPVYGWWESLLDQAIPGWRLSLVELETQSRQLRVKSEFWSRVAELEPEQAREELARVAKCQARTQEQVAELAGKLETASALAKSAWPNWQRGMATLLASGGLAGFEPIPEVLECLWQPLCRLDDDVGAADAVQAWLHERNLCQAQDHFYWQS exsceba promoter promoter of exsCEBA operon dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid pseai Pseudomonas aeruginosa GCGATGTGGCTTTTTTCTTAAAAGAAAAGTCTCTCAGTGACAAAAGCGATGCATAGCCCG exsceba_promote-exsa 1330941 n/a 1330944 unspecified role unspecified role prey prey histag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) n/a 1330945 unspecified role unspecified role prey prey ecoli Escherichia coli (strain K12) n/a 1330946 unspecified role unspecified role bait bait direct interaction direct interaction false false false Figure 5B exsceba_promo-exsa-2 1330941 n/a 1330946 unspecified role unspecified role bait bait n/a 1330944 unspecified role unspecified role prey prey histag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Figure 5A exsceba_promo-exsa-1 1330941 n/a 1330946 unspecified role unspecified role bait bait n/a 1330944 unspecified role unspecified role prey prey histag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false ecoli Escherichia coli (strain K12) n/a 1330945 unspecified role unspecified role prey prey ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Figure 5C exsa-exsceba_promote 1330942 n/a 1330944 unspecified role unspecified role neutral component neutral component histag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) n/a 1330946 unspecified role unspecified role neutral component neutral component n/a 1330945 unspecified role unspecified role neutral component neutral component ecoli Escherichia coli (strain K12) physical association physical association false false false Figure 3C exsa-exsceba_promo-1 1330942 n/a 1330945 unspecified role unspecified role neutral component neutral component ecoli Escherichia coli (strain K12) n/a 1330944 unspecified role unspecified role neutral component neutral component histag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false Figure 3C exsa-exsa 1330943 n/a 1330944 unspecified role unspecified role neutral component neutral component histag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) n/a 1330946 unspecified role unspecified role neutral component neutral component direct interaction direct interaction false false false Figure 6