IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ freitas-2008-1 A systematic approach to identify STRE-binding proteins of the gsn glycogen synthase gene promoter in Neurospora crassa. in vitro In vitro affinity chrom affinity chromatography technology Affinity purification Affinity purification affinity chrom de novo protein sequence de novo protein sequencing by mass spectrometry de novo protein sequence Freitas FZ., Chapeaurouge A., Perales J., Bertolini MC. Biochemical approaches together with mass spectrometric analysis were used to identify the proteins that bind to the STRE motif (DNA lelement. Crude nuclear extract of heat-shocked mycelium was prepared and fractionated by affinity chromatography. The fractions exhibiting DNA-binding activity were identified by electrophoretic mobility shift assay (EMSA) using as probe a DNA fragment containing the STRE motif. The molecular mass (MM) of proteins was estimated by fractionating the crude nuclear extract by SDS-PAGE followed by EMSA analysis of the proteins corresponding to different MM intervals. Binding activity was detected at the 30-50 MM kDa interval. Fractionation of the crude nuclear proteins by IEF followed by EMSA analysis led to the identification of two active fractions belonging to the pIs intervals 3.54-4.08 and 6.77-7.31. The proteins comprising the MM and pI intervals previously identified were excised from a 2-DE gel, and subjected to mass spectrometric analysis (MALDI-TOF/TOF) after tryptic digestion. The proteins were identified by search against the MIPS and MIT N. crassa databases and five promising candidates were identified. The DNA sequence of the probe was obtained from the reference Freitas et al (PMID:15558319). The DNA sequence of the accession number provided (AF417205) was analysed to detect the cloning Nco1 and BglII sites and the 158 base pair fragment sequence taken as the probe sequence. mcbertol@iq.unesp.br Proteomics (1615-9853) 2008 Only protein-protein interactions imex curation gsn-neucr-dna Glycogen synthase upstream region dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid neucr Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) ATCTGGAGGACCCTCCGTAGATAATATACTTACAGTCGTACCCAAGGTAGAGTAATCCACTGAAATCGGGATCCCCCTTGAATACTTTGGGGTAAGGCTCGTGGGAAGACAAAGCGCGGCAGAGCTTCATGTTCAGATACATGGACTCTGAAATGCCC The sequence was obtained from the reference Freitas et al (PMID:15558319). The DNA sequence of the accession number provided (AF417205) was analysed to detect the cloning Nco1 and BglII sites and the 158 base pair fragment sequence provided above. eif3f_neucr Eukaryotic translation initiation factor 3 subunit F 1A9.200 NCU01021 protein protein neucr Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) MAVDQESFVHLSRPLAPNVLGFGVSNAPLTVNIQPQAVFSIIDHAVRRDDRDTQSTRVIGALVGVRSEDGSEVEVRSTFAIPHTENEDQVEVDVEYQKNMLALTLKANPRETLLGWYTTSHELNSFSALIQNFFASPETGTFPHPAVHLTIGTEAGATIDTKTYISAPVAVSPERAAESCLFIEVPHKLLFTDAERGALGSVAAAADAESRSAPVVSDIENLAQALETVSDLLERVSGFVGEVLDEERDGNHALGQYLMNALSLAPKVSNLAIENDFNNHIQDVLMVSYLANTIRTQIELSQRLATAKLDEGKEGGEKKDGEGAEGDKKTDGQRGQRGQGGKRGGRSGGAGGRGGREQREPREPREAAE hat2_neucr Histone acetyltransferase type B subunit 2 hat-2 NCU06679 protein protein neucr Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) MARDEIVDDVDVNMEEDDAEAEQRLINEEYKIWKKNSPFLYDMMLSTALEWPTLTTQWFPDVKNPKDKSHTVHRLLLGTHTAEGKPNYLQIAEVEIPKMVELNPRDYDEERGEIGGYGSKASSGEPLCIRFKITQKIDHPGEVNKARYQPQNPDIIATLAVDGRVLIFDRTKHSITPSGTPSPQLELIGHKEEGFGLNWNPHEEGCLVTGSEDKTVLLWDLKTYEGTSKQLKYSRKYTHHSHIVNDVQHHPLVKSWIGTVSDDLTLQIIDVRRPETDKAAIVARNGHSDAINALAFNPRVETIIATASADKTIGIWDMRNMKSKVHTLEGHQDAVTSLEWHPTESAILGSGSYDRRLLFWDISRVGDEQTQDDAEDGPPELLFMHGGHTNHLADFSWNRNDPWLVCSAAEDNLLQIWKVANSIVSKEPADMSTPELDDPKPKQSSH eif3i_neucr Eukaryotic translation initiation factor 3 subunit I NCU03876 tif-34 Eukaryotic translation initiation factor 3 39 kDa subunit homolog protein protein neucr Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) MRPILLSGHERALTQIKYNRDGDLLFSVSKDQQICVWFAHNGERLGTYHGHQGAIWTIDVDPTSTILASGSADNTIRLWEIKTGRLLKTWDFPTAVKRVEFSEDGSKLLGVTEKRMGHLGTIVVLDIKLDVDAEQSDEKAMTIVCEDSKATVAGWSYLSKYIIAGHEDGSVSQFDGKNGDLLYNIPIHELNQPITDLQWSHDRTYFITASKDKTSKLITAKDLEVLKTYPADTPLNSATITRKKDFVILGGGQAAMDVTTTSARQGKFEARFYHKIFESEIGRVRGHFGPLNTVAADPTGKSYASGGEDGYVRIHHFDKGYFDFMYEVERERQNKLNQQQQQTISA q7s4d5_neucr NCU02424 protein protein neucr Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) MLIRLSALAVAAASIVNGLSPADIPSDLPLSNLLASAQSHLSKGETSDALVYYDAAIARDPSNYLTFFKRATTYLSLGRTSQATDDFNKVLALKPGFEGAHIQLGKLKARSADWDAAREHYEKAKKVNELVALEGAADAAGLAEKAAASGDWEECVTQAGAAIMVANRAVALRQLRSKCLFERGDLEMGMSDLQHILQMKPGDTTPHLKISAISFYALGDLPGGLAAIRKCLHSDPDSKVCAALLKEEKMTDKLVQKAIKALDKKQPMTAVKNLIPNREGEGLIQEVKNQVEKLRADGTIPKSAGNVLVGQLVELACQAYFESNSKKASTYCVESLAINPTALYALLYQSQVQMAAEEYDAAIATLQKALEEHPAKSDVINPLIQKAQIALKRSKTKDYYKVLGVSHDADERQIKSAYRKLSKIHHPDKAAKQGLTKEAAEKKMAQINEAYEVLSDPELRARFDRGDDPNSHEGQQGGQPFGGHGGNQYMFQQGGPGGGFRFQYGSGGFPGGFPFGG ruvb1_neucr RuvB-like helicase 1 hel-1 rvb1 B8L21.150 NCU03482 protein protein neucr Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) MVQISEVKGNSRDNRTAAHTHIKGLGLNSQGIAEKQASGFVGQTTAREACGVVVDLIKAHKMAGRGVLLAGGPGTGKTALALAISQELGTKIPFCPITGSEIYSTEVKKTEVLMENFRRAIGLKVRETKEVYEGEVTELTPEEAENPLGGYGKTITTLLIGLKSAKGQKKLRLDPSIYEAIQKERVTVGDVIYIEANTGACKRVGRSDAYATEFDLEAEEYVPIPKGEVHKKKEIVQDVSLHDLDVANARPQGGQDIMSMMGQLMKPKMTEITDKLRSEINKVVSKYIDQGVAELVPGVLFIDEAHMLDVECFTYLNKALESPISPIVVLASNRGMTGIRGAEDLVAAHGIPPDFLSRLLIIPTTAYDPEEIKRIVKIRSTTEGVKITEAAIDKIAEHGVRISLRYCLQLLTPASILAKVNGRNEIDVQDVAECEDLFLDARRSAALLSSEQGQEFIC dna-ncu02424 A 158 base pair region of the GlycogenSynthase upstream region interacts with a number of proteins 740220 N/A 740221 unspecified role unspecified role bait bait N/A 740222 unspecified role unspecified role prey prey neucr Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) N/A 740223 unspecified role unspecified role prey prey neucr Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) N/A 740224 unspecified role unspecified role prey prey neucr Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) N/A 740225 unspecified role unspecified role prey prey neucr Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) N/A 740226 unspecified role unspecified role prey prey association association false false false Table 1