IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ sauvageau-2005-2 Fission yeast rad51 and dmc1, two efficient DNA recombinases forming helical nucleoprotein filaments. in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa full dna sequence full identification by DNA sequencing full dna sequence Sauvageau S., Stasiak AZ., Banville I., Ploquin M., Stasiak A., Masson JY. Rhp51 and Dmc1 bound preferentially to ssDNA (100 nucleotides) over dsDNA (100 nucleotides). Moreover, 3'-tailed DNA (50_mer) was bound more preferentially than the 5'-tailed DNA (50_mer) by rhp51 and dmc1. Jean-Yves.Masson@crhdq.ulaval.ca Jean-Yves.Massom@crhdq.ulaval.ca Mol. Cell. Biol. (0270-7306) 2005 Only protein-protein interactions imex curation sauvageau-2005-1 Fission yeast rad51 and dmc1, two efficient DNA recombinases forming helical nucleoprotein filaments. yeasx Saccharomyces cerevisiae (Baker's yeast) Baker's yeast 2 hybrid two hybrid 2H 2h Gal4 transcription regeneration two-hybrid yeast two hybrid 2-hybrid classical two hybrid classical two hybrid 2H two-hybrid 2-hybrid Gal4 transcription regeneration 2h yeast two hybrid Y2H Y-2H 2 hybrid predetermined predetermined participant predetermined Sauvageau S., Stasiak AZ., Banville I., Ploquin M., Stasiak A., Masson JY. Jean-Yves.Masson@crhdq.ulaval.ca Jean-Yves.Massom@crhdq.ulaval.ca Mol. Cell. Biol. (0270-7306) 2005 Only protein-protein interactions imex curation sauvageau-2005-3 Fission yeast rad51 and dmc1, two efficient DNA recombinases forming helical nucleoprotein filaments. in vitro In vitro molecular sieving molecular sieving Gel Filtration Size Exclusion Chromatography Size Exclusion Chromatography Gel Filtration Sizing column predetermined predetermined participant predetermined Sauvageau S., Stasiak AZ., Banville I., Ploquin M., Stasiak A., Masson JY. Jean-Yves.Masson@crhdq.ulaval.ca Jean-Yves.Massom@crhdq.ulaval.ca Mol. Cell. Biol. (0270-7306) 2005 Only protein-protein interactions imex curation 100_merds ds dna double stranded deoxyribonucleic acid ds DNA ds dna in vitro In vitro GGGCGAATTGGGCCCGACGTCGCATGCTCCTCTAGACTCGAGGAATTCGGTACCCCGGGTTCGAAATCGATAAGCTTACAGTCTCCATTTAAAGGACAAG rad51_schpo DNA repair protein rhp51 rhp51 rad51 SPAC644.14c RAD51 homolog protein protein schpo Schizosaccharomyces pombe (strain ATCC 38366 / 972) Fission yeast MADTEVEMQVSAADTNNNENGQAQSNYEYDVNVQDEEDEAAAGPMPLQMLEGNGITASDIKKIHEAGYYTVESIAYTPKRQLLLIKGISEAKADKLLGEASKLVPMGFTTATEYHIRRSELITITTGSKQLDTLLQGGVETGSITELFGEFRTGKSQICHTLAVTCQLPIDMGGGEGKCLYIDTEGTFRPVRLLAVADRYGLNGEEVLDNVAYARAYNADHQLELLQQAANMMSESRFSLLVVDSCTALYRTDFSGRGELSARQMHLARFMRTLQRLADEFGIAVVITNQVVAQVDGISFNPDPKKPIGGNILAHSSTTRLSLRKGRGEQRICKIYDSPCLPESEAIFAINSDGVGDPKEIIAPV 9F26EB9FA4F3C2BA 50_mer5 ss dna single stranded deoxyribonucleic acid ss DNA ss dna in vitro In vitro GGGCGAATTGGGCCCGACGTCGCATGCTCCTCTAGACTCGAGGAATTCGG 100_merds-1 ds dna double stranded deoxyribonucleic acid ds DNA ds dna in vitro In vitro GGGCGAATTGGGCCCGACGTCGCATGCTCCTCTAGACTCGAGGAATTCGGTACCCCGGGTTCGAAATCGATAAGCTTACAGTCTCCATTTAAAGGACAAG 100_merss ss dna single stranded deoxyribonucleic acid ss DNA ss dna in vitro In vitro GGGCGAATTGGGCCCGACGTCGCATGCTCCTCTAGACTCGAGGAATTCGGTACCCCGGGTTCGAAATCGATAAGCTTACAGTCTCCATTTAAAGGACAAG dmc1_schpo Meiotic recombination protein dmc1 dmc1 dmp1 SPAC8E11.03c protein protein schpo Schizosaccharomyces pombe (strain ATCC 38366 / 972) Fission yeast MEEFAEGNDDEQMIFSDIEDLTAHGIGMTDIIKLKQAGVCTVQGVHMSTKRFLLKIKGFSEAKVDKLKEAASKMCPANFSTAMEISQNRKKVWSISTGSEALNGILGGGIQSMSITEVFGEFRCGKTQMSHTLCVTAQLPRDMGGAEGKVAFIDTEGTFRPDRIKAIAERFGVDADQAMENIIVSRAYNSEQQMEYITKLGTIFAEDGQYRLLIVDSIMALFRVDYSGRGELSERQQKLNIMLARLNHISEEFNVAVFVTNQVQADPGAAMMFASNDRKPVGGHVMAHASATRLLLRKGRGEERVAKLNDSPDMPEAECSYVITPGGIADVS 86B73EAA491F7B02 rad51_human DNA repair protein RAD51 homolog 1 RAD51 RAD51A RECA RAD51 homolog A protein protein human Homo sapiens Human MAMQMQLEANADTSVEEESFGPQPISRLEQCGINANDVKKLEEAGFHTVEAVAYAPKKELINIKGISEAKADKILAEAAKLVPMGFTTATEFHQRRSEIIQITTGSKELDKLLQGGIETGSITEMFGEFRTGKTQICHTLAVTCQLPIDRGGGEGKAMYIDTEGTFRPERLLAVAERYGLSGSDVLDNVAYARAFNTDHQTQLLYQASAMMVESRYALLIVDSATALYRTDYSGRGELSARQMHLARFLRMLLRLADEFGVAVVITNQVVAQVDGAAMFAADPKKPIGGNIIAHASTTRLYLRKGRGETRICKIYDSPCLPEAEAMFAINADGVGDAKD rhp51-100_merds EMSA showing binding of rhp51 to a 100_mer ds dna 545875 N/A 545878 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 mobility shift mobility shift undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 545879 unspecified role unspecified role neutral component neutral component physical association physical association false false false Figure 3A rhp51-50_mer5 EMSA showing binding of rhp51 to a 50_mer 5' ss dna 545875 N/A 545880 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 mobility shift mobility shift undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 545879 unspecified role unspecified role neutral component neutral component physical association physical association false false false Figure 3A rhp51-50_mer3 EMSA showing binding of rhp51 to a 50_mer 3' ss dna 545875 N/A 545881 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 mobility shift mobility shift undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 545879 unspecified role unspecified role neutral component neutral component physical association physical association false false false Figure 3A rhp51-100_merss EMSA showing binding of rhp51 to a 100_mer ss dna 545875 N/A 545882 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 mobility shift mobility shift undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 545879 unspecified role unspecified role neutral component neutral component physical association physical association false false false Figure 3A dmc1-100_merds EMSA showing binding of dmc1 to a 100_mer ds dna 545875 N/A 545883 unspecified role unspecified role neutral component neutral component N/A 545878 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 mobility shift mobility shift undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false physical association physical association false false false Figure 3B dmc1-100_merss EMSA showing binding of dmc1 to a 100_mer ss dna 545875 N/A 545883 unspecified role unspecified role neutral component neutral component N/A 545882 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 mobility shift mobility shift undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false physical association physical association false false false Figure 3B dmc1-50_mer5 EMSA showing binding of dmc1 to a 50_mer 5' ss dna 545875 N/A 545883 unspecified role unspecified role neutral component neutral component N/A 545880 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 mobility shift mobility shift undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false physical association physical association false false false Figure 3B dmc1-50_mer3 EMSA showing binding of dmc1 to a 50_mer 3' ss dna 545875 N/A 545883 unspecified role unspecified role neutral component neutral component N/A 545881 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 mobility shift mobility shift undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false physical association physical association false false false Figure 3B rhp51-rhp51-1 Y2H showing self interaction of rhp51-schpo. 545876 N/A 545879 unspecified role unspecified role prey prey n-terminus binding region binding-associated region binding region deletion analysis deletion analysis certain certain sequence position certain certain certain sequence position certain false N/A 545879 unspecified role unspecified role bait bait physical association physical association false false false Figure 2A rhp51-rhp51-2 Y2H interaction between rhp51-schpo and rhp51-human 545876 N/A 545879 unspecified role unspecified role bait bait N/A 545884 unspecified role unspecified role prey prey physical association physical association false false false Figure 2A Shows interaction between the human and schpo rhp51 occurs due to critical amino acid residues for self interaction being conserved between proteins across species. dmc1-dmc1-2 Y2H showing self interaction of dmc1-schpo. 545876 N/A 545883 unspecified role unspecified role bait bait N/A 545883 unspecified role unspecified role prey prey n-terminus required to bind necessary binding region required to bind deletion analysis deletion analysis certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false Figure 2B; 2C; 2D. The self interacting domain of dmc1 was mapped to the n-terminus AA 1-55 dmc1-dmc1-3 Gel filtration showing self interaction of dmc1-schpo. 545877 N/A 545883 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Stoichiometry: 8.0 physical association physical association false false false Figure 1C This indicates that dmc1 self interacts forming an octameric complex. rhp51-rhp51-3 Gel filtration showing self interaction of rhp51-schpo. 545877 N/A 545879 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Stoichiometry: 8.0 physical association physical association false false false Figure 1D Indicates that Rad51 forms an octameric complex.