IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ wu-2021-14 ecoli Escherichia coli (strain K12) dls dynamic light scattering dls experimental particp experimental participant identification experimental particp Wu C., Qavi AJ., Hachim A., Kavian N., Cole AR., Moyle AB., Wagner ND., Sweeney-Gibbons J., Rohrs HW., Gross ML., Peiris JSM., Basler CF., Farnsworth CW., Valkenburg SA., Amarasinghe GK., Leung DW. Virus - Publications including interactions involving viral proteins cwfarnsworth@wustl.edu,gamarasinghe@wustl.edu,dwleung@wustl.edu iScience 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus wu-2021-15 in vitro In vitro fps fluorescence polarization spectroscopy Fluorescence anisotropy FPS FPS Fluorescence anisotropy fps tag fluorescence tag visualisation by fluorescence tag fluorescence Wu C., Qavi AJ., Hachim A., Kavian N., Cole AR., Moyle AB., Wagner ND., Sweeney-Gibbons J., Rohrs HW., Gross ML., Peiris JSM., Basler CF., Farnsworth CW., Valkenburg SA., Amarasinghe GK., Leung DW. Virus - Publications including interactions involving viral proteins cwfarnsworth@wustl.edu,gamarasinghe@wustl.edu,dwleung@wustl.edu iScience 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus wu-2021-16 in vitro In vitro h1-h2 ms mass spectrometry study of hydrogen/deuterium exchange h1-h2 ms sequence tag sequence tag identification sequence tag Wu C., Qavi AJ., Hachim A., Kavian N., Cole AR., Moyle AB., Wagner ND., Sweeney-Gibbons J., Rohrs HW., Gross ML., Peiris JSM., Basler CF., Farnsworth CW., Valkenburg SA., Amarasinghe GK., Leung DW. Virus - Publications including interactions involving viral proteins cwfarnsworth@wustl.edu,gamarasinghe@wustl.edu,dwleung@wustl.edu iScience 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus ncap_sars2 Nucleoprotein N Nucleocapsid protein protein protein SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV MSDNGPQNQRNAPRITFGGPSDSTGSNQNGERSGARSKQRRPQGLPNNTASWFTALTQHGKEDLKFPRGQGVPINTNSSPDDQIGYYRRATRRIRGGDGKMKDLSPRWYFYYLGTGPEAGLPYGANKDGIIWVATEGALNTPKDHIGTRNPANNAAIVLQLPQGTTLPKGFYAEGSRGGSQASSRSSSRSRNSSRNSTPGSSRGTSPARMAGNGGDAALALLLLDRLNQLESKMSGKGQQQQGQTVTKKSAAEASKKPRQKRTATKAYNVTQAFGRRGPEQTQGNFGDQELIRQGTDYKHWPQIAQFAPSASAFFGMSRIGMEVTPSGTWLTYTGAIKLDDKDPNFKDQVILLNKHIDAYKTFPPTEPKKDKKKKADETQALPQRQKKQQTVTLLPAADLDDFSKQLQQSMSSADSTQA 20-nt ssrna rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) UUUCACCUCCCUUUCAGUUU stem-loop-rna rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) GGAAGAUUAAUAAUUUUCC n-n-80 4062345 N/A 4062348 predetermined predetermined participant predetermined sequence tag sequence tag identification sequence tag unspecified role unspecified role neutral component neutral component purified purified region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false NTD-LKR-CTD region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false N/A 4062348 predetermined predetermined participant predetermined sequence tag sequence tag identification sequence tag unspecified role unspecified role neutral component neutral component purified purified region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false NTD-LKR-CTD region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false direct interaction direct interaction false false false 1C, Supp. figure 2 There are two major oligomeric species for full-length N (NWT; 46 kDa), with hydrodynamic radii (Rh) of 8.9 nm and 450 nm (Figures 1C and 1D), suggesting the presence of different oligomeric forms of the protein. For truncated NNTD-LKR-CTD construct results show two major species that are similar to N-WT. However, both NNTD-LKR-CTD populations display reduced polydispersity. n-n-81 4062345 N/A 4062348 predetermined predetermined participant predetermined sequence tag sequence tag identification sequence tag unspecified role unspecified role neutral component neutral component purified purified region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false NTD-LKR region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false CTD region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false Stoichiometry: 2.0 direct interaction direct interaction false false false 1C, Supp. figure 2 N CTD is a dimer in solution;N NTD-LKR results in a single peak representing a dimeric species. 20_nt ssrna-n-1 4062346 N/A 4062349 unspecified role unspecified role neutral component neutral component region fitc labelled fluorescein isothiocyanate label fluorescein isothiocyanate labbeled FITC labelled FITC labelled fluorescein isothiocyanate labbeled fitc labelled undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4062348 unspecified role unspecified role neutral component neutral component NTD-LKR-CTD region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false CTD sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false P0DTC9:p.[Ser176Asp;Ser188Asp;Ser206Asp] mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false LKR-CTD region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false NTD-LKR-CTD -Carm-region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false NTD-LKR region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false NTD sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false P0DTC9:p.[Ser188Asp;Ser206Asp] mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false 4062346 2, 4E, Supp. figure 3,5 Figure 4E gives these Kd values: For the S176D/S188D/S206D mutant:- N=0.015uM (WT =0.007uM); N-NTD-LKR=1.1uM (WT=0.5uM). Supp. figure 5A gives these Kd values:- For the S176D/S188D/S206D mutant:- N=0.023uM (WT =0.007uM); For the N S188D/S206D mutant= 0.015 uM. No Kd value is given for the LKR-CTD region. 20_nt ssrna-n-2 4062346 N/A 4062350 unspecified role unspecified role neutral component neutral component region fitc labelled fluorescein isothiocyanate label fluorescein isothiocyanate labbeled FITC labelled FITC labelled fluorescein isothiocyanate labbeled fitc labelled undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4062348 unspecified role unspecified role neutral component neutral component NTD-LKR-CTD region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false CTD sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false NTD-LKR-CTD -Carm-region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false NTD-LKR region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false NTD sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false LKR+CTD region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false P0DTC9:p.[Ser176Asp;Ser188Asp;Ser206Asp] mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false 4062346 2, Supp. figure 3, 5 Supp. Figure 5 give Kd for N NTD-LKR as 3.0uM, while Figure 2 gives a value of 2.5uM. 20_nt ssrna-n-3 4062347 N/A 4062348 unspecified role unspecified role neutral component neutral component P0DTC9:p.[Ser176Asp;Ser188Asp;Ser206Asp] mutation mutation certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false NTD-LKR region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 4062349 unspecified role unspecified role neutral component neutral component region fitc labelled fluorescein isothiocyanate label fluorescein isothiocyanate labbeled FITC labelled FITC labelled fluorescein isothiocyanate labbeled fitc labelled undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false 3, Supp. figure 4