IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ jia-2019-4 in vitro In vitro enzymatic study enzymatic study tag fluorescence tag visualisation by fluorescence tag fluorescence Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z., Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z. Virus - Publications including interactions involving viral proteins H/D Exchange Experiments involving dsDNA have not been annotated as the sequence of DNA used is unclear. Helicase Assay:(Duplex) Nucleic acid unwinding assay. The reaction of dsDNA unwinding to ssDNA was monitored by a reduction of quenching (by BHQ), -resulting in an increase in fluorescence on strand separation. Method using BHQ (Black Hole Quencher): Two fluorescently modified short oligonucleotides were annealed. One oligo was modified with cyanine 3 (Cy3), whereas the other is modified with a spectrally paired black hole quencher (BHQ) tag. Complete separation of the Cy3-modified strand is detected as an increase in total fluorescence. Black Hole Quencher® dyes are true "dark" quenchers with no fluorescent signal. raozh@mail.tsinghua.edu.cn Nucleic acids research 2019 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus jia-2019-1 in vitro In vitro atpase assay atpase assay predetermined predetermined participant predetermined Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z., Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z. Virus - Publications including interactions involving viral proteins H/D Exchange Experiments involving dsDNA have not been annotated as the sequence of DNA used is unclear. This is a coupled ATPase assay; the rate of NADH absorbance decrease at 340 nm, is measured, which is proportional to the rate of steady-state ATP hydrolysis. The single stranded DNA used in this assay has been assumed to be "dT25" (25 thymine residues), as given under "Crystallization, data collection and structure determination", as this is the only single stranded DNA mentioned in the publication. raozh@mail.tsinghua.edu.cn Nucleic acids research 2019 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus jia-2019-3 in vitro In vitro h1-h2 ms mass spectrometry study of hydrogen/deuterium exchange h1-h2 ms ms participant Identification by mass spectrometry ms participant Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z., Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z. Virus - Publications including interactions involving viral proteins H/D Exchange Experiments involving dsDNA have not been annotated as the sequence of DNA used is unclear. The single stranded DNA used in this assay has been assumed to be "dT25" (25 thymine residues), as given under "Crystallization, data collection and structure determination", as this is the only single stranded DNA mentioned in the publication. raozh@mail.tsinghua.edu.cn Nucleic acids research 2019 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus jia-2019-2 in vitro In vitro enzymatic study enzymatic study weight identificat confirmation by molecular weight weight identificat Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z., Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z. Virus - Publications including interactions involving viral proteins H/D Exchange Experiments involving dsDNA have not been annotated as the sequence of DNA used is unclear. Helicase Assay:(Duplex) Nucleic acid unwinding assay. It has been assumed that Figure 1 results are derived using this method. raozh@mail.tsinghua.edu.cn Nucleic acids research 2019 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus jia-2019-5 in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight by staining molecular weight estimation by staining weight by staining Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z., Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z. Virus - Publications including interactions involving viral proteins The DNA sequence used is unclear H/D Exchange Experiments involving dsDNA have not been annotated as the sequence of DNA used is unclear. raozh@mail.tsinghua.edu.cn Nucleic acids research 2019 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus jia-2019-6 in vitro In vitro spr surface plasmon resonance Optical biosensor BIAcore(r) BIAcore(r) Optical biosensor spr predetermined predetermined participant predetermined Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z., Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z. Virus - Publications including interactions involving viral proteins H/D Exchange Experiments involving dsDNA have not been annotated as the sequence of DNA used is unclear. raozh@mail.tsinghua.edu.cn Nucleic acids research 2019 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus p0c6x7-pro_0000037319 Helicase nsp13 ORF1ab polyprotein 1a-1b rep protein protein sars-cov Human SARS coronavirus SARS-CoV Severe acute respiratory syndrome coronavirus AVGACVLCNSQTSLRCGACIRRPFLCCKCCYDHVISTSHKLVLSVNPYVCNAPGCDVTDVTQLYLGGMSYYCKSHKPPISFPLCANGQVFGLYKNTCVGSDNVTDFNAIATCDWTNAGDYILANTCTERLKLFAAETLKATEETFKLSYGIATVREVLSDRELHLSWEVGKPRPPLNRNYVFTGYRVTKNSKVQIGEYTFEKGDYGDAVVYRGTTTYKLNVGDYFVLTSHTVMPLSAPTLVPQEHYVRITGLYPTLNISDEFSSNVANYQKVGMQKYSTLQGPPGTGKSHFAIGLALYYPSARIVYTACSHAAVDALCEKALKYLPIDKCSRIIPARARVECFDKFKVNSTLEQYVFCTVNALPETTADIVVFDEISMATNYDLSVVNARLRAKHYVYIGDPAQLPAPRTLLTKGTLEPEYFNSVCRLMKTIGPDMFLGTCRRCPAEIVDTVSALVYDNKLKAHKDKSAQCFKMFYKGVITHDVSSAINRPQIGVVREFLTRNPAWRKAVFISPYNSQNAVASKILGLPTQTVDSSQGSEYDYVIFTQTTETAHSCNVNRFNVAITRAKIGILCIMSDRDLYDKLQFTSLEIPRRNVATLQ 5302 5902 5'-3' long strand dna_2 ss dna single stranded deoxyribonucleic acid ss DNA ss dna synthetic construct synthetic construct AATGTCTGACGTAAAGCCTCTAAAATGTCTG atp ATP Adenosine 5'-triphosphate Adenosine triphosphate ADENOSINE-5'-TRIPHOSPHATE Adephos Adetol Adynol Atipi ATP Atriphos Cardenosine Fosfobion Glucobasin H4atp Myotriphos Triadenyl Triphosphaden adenosine 5'-(tetrahydrogen triphosphate) small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) 5'-3' short strand dna ss dna single stranded deoxyribonucleic acid ss DNA ss dna synthetic construct synthetic construct CAGACATTTTAGAGG p0c6x7-pro_0000037318 RNA-directed RNA polymerase nsp12 rep ORF1ab polyprotein 1a-1b protein protein sars-cov Human SARS coronavirus SARS-CoV Severe acute respiratory syndrome coronavirus SADASTFLNRVCGVSAARLTPCGTGTSTDVVYRAFDIYNEKVAGFAKFLKTNCCRFQEKDEEGNLLDSYFVVKRHTMSNYQHEETIYNLVKDCPAVAVHDFFKFRVDGDMVPHISRQRLTKYTMADLVYALRHFDEGNCDTLKEILVTYNCCDDDYFNKKDWYDFVENPDILRVYANLGERVRQSLLKTVQFCDAMRDAGIVGVLTLDNQDLNGNWYDFGDFVQVAPGCGVPIVDSYYSLLMPILTLTRALAAESHMDADLAKPLIKWDLLKYDFTEERLCLFDRYFKYWDQTYHPNCINCLDDRCILHCANFNVLFSTVFPPTSFGPLVRKIFVDGVPFVVSTGYHFRELGVVHNQDVNLHSSRLSFKELLVYAADPAMHAASGNLLLDKRTTCFSVAALTNNVAFQTVKPGNFNKDFYDFAVSKGFFKEGSSVELKHFFFAQDGNAAISDYDYYRYNLPTMCDIRQLLFVVEVVDKYFDCYDGGCINANQVIVNNLDKSAGFPFNKWGKARLYYDSMSYEDQDALFAYTKRNVIPTITQMNLKYAISAKNRARTVAGVSICSTMTNRQFHQKLLKSIAATRGATVVIGTSKFYGGWHNMLKTVYSDVETPHLMGWDYPKCDRAMPNMLRIMASLVLARKHNTCCNLSHRFYRLANECAQVLSEMVMCGGSLYVKPGGTSSGDATTAYANSVFNICQAVTANVNALLSTDGNKIADKYVRNLQHRLYECLYRNRDVDHEFVDEFYAYLRKHFSMMILSDDAVVCYNSNYAAQGLVASIKNFKAVLYYQNNVFMSEAKCWTETDLTKGPHEFCSQHTMLVKQGDDYVYLPYPDPSRILGAGCFVDDIVKTDGTLMIERFVSLAIDAYPLTKHPNQEYADVFHLYLQYIRKLHDELTGHMLDMYSVMLTNDNTSRYWEPEFYEAMYTPHTVLQ 4370 5301 k9n7c7-pro_0000422449 RNA-directed RNA polymerase rep ORF1ab polyprotein 1a-1b protein protein cvemc Middle East respiratory syndrome-related coronavirus (isolate United Kingdom/H123990006/2012) (Betacoronavirus England 1) Betacoronavirus England 1 Human coronavirus EMC SKDSNFLKRVRGSIVNARIEPCSSGLSTDVVFRAFDICNYKAKVAGIGKYYKTNTCRFVELDDQGHHLDSYFVVKRHTMENYELEKHCYDLLRDCDAVAPHDFFIFDVDKVKTPHIVRQRLTEYTMMDLVYALRHFDQNSEVLKAILVKYGCCDVTYFENKLWFDFVENPSVIGVYHKLGERVRQAILNTVKFCDHMVKAGLVGVLTLDNQDLNGKWYDFGDFVITQPGSGVAIVDSYYSYLMPVLSMTDCLAAETHRDCDFNKPLIEWPLTEYDFTDYKVQLFEKYFKYWDQTYHANCVNCTDDRCVLHCANFNVLFAMTMPKTCFGPIVRKIFVDGVPFVVSCGYHYKELGLVMNMDVSLHRHRLSLKELMMYAADPAMHIASSNAFLDLRTSCFSVAALTTGLTFQTVRPGNFNQDFYDFVVSKGFFKEGSSVTLKHFFFAQDGNAAITDYNYYSYNLPTMCDIKQMLFCMEVVNKYFEIYDGGCLNASEVVVNNLDKSAGHPFNKFGKARVYYESMSYQEQDELFAMTKRNVIPTMTQMNLKYAISAKNRARTVAGVSILSTMTNRQYHQKMLKSMAATRGATCVIGTTKFYGGWDFMLKTLYKDVDNPHLMGWDYPKCDRAMPNMCRIFASLILARKHGTCCTTRDRFYRLANECAQVLSEYVLCGGGYYVKPGGTSSGDATTAYANSVFNILQATTANVSALMGANGNKIVDKEVKDMQFDLYVNVYRSTSPDPKFVDKYYAFLNKHFSMMILSDDGVVCYNSDYAAKGYIAGIQNFKETLYYQNNVFMSEAKCWVETDLKKGPHEFCSQHTLYIKDGDDGYFLPYPDPSRILSAGCFVDDIVKTDGTLMVERFVSLAIDAYPLTKHEDIEYQNVFWVYLQYIEKLYKDLTGHMLDSYSVMLCGDNSAKFWEEAFYRDLYSSPTTLQ 4378 5310 ssdna_dt25 25 thymine single-stranded DNA ss dna single stranded deoxyribonucleic acid ss DNA ss dna synthetic construct synthetic construct TTTTTTTTTTTTTTTTTTTTTTTTT 5'-3' long strand dna_1 ss dna single stranded deoxyribonucleic acid ss DNA ss dna synthetic construct synthetic construct AATGTCTGACGTAAAGCCTCTAAAATGTCT 5'_3' long strand dna_2-5'_3' short strand dna-1 3937755 N/A 3937761 enzyme enzyme neutral component neutral component purified purified P0C6X7-PRO_0000037319:p.Lys288Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.Ser289Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.Asp374Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.Glu375Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.Gln404Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.Arg567Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.Arg442Ala mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 3937762 enzyme target enzyme target substrate substrate neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false BHQ quencher dye labelled dye label dye labelled certain certain sequence position certain certain certain sequence position certain false synthetic construct synthetic construct N/A 3937763 ancillary ancillary neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3937764 enzyme target enzyme target substrate substrate neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false 5' label cy3 label cy3 label certain certain sequence position certain certain certain sequence position certain false synthetic construct synthetic construct 3937783 3937779 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false 2 D-G, Supp. figure 3 The initial dsDNA concentration was 250 nM. 5'_3' long strand dna_2-5'_3' short strand dna-2 3937755 N/A 3937761 enzyme enzyme neutral component neutral component purified purified P0C6X7-PRO_0000037319:p.[Arg337Ala;Arg339Ala] mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.[Lys345Ala;Lys347Ala] mutation disrupting rate mutation disrupting interaction rate mutation disrupting rate certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.Arg507_Lys508delinsAlaAla mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.[Lys524Ala;Gln531Ala] mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.[Ser539Ala;Tyr541Ala] mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.[Asn179Ala;Arg212Ala] mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.Asn102Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.Lys131Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 3937762 enzyme target enzyme target substrate substrate neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false BHQ quencher dye labelled dye label dye labelled certain certain sequence position certain certain certain sequence position certain false synthetic construct synthetic construct N/A 3937763 ancillary ancillary neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3937764 enzyme target enzyme target substrate substrate neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false 5' label cy3 label cy3 label certain certain sequence position certain certain certain sequence position certain false synthetic construct synthetic construct 3937800 3937796 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false 4 C/D, 6 E/F The initial dsDNA concentration was 400 nM. 5'_3' long strand dna_2-5'_3' short strand dna-3 3937755 N/A 3937761 enzyme enzyme neutral component neutral component purified purified ecoli Escherichia coli (strain K12) N/A 3937765 stimulator stimulator neutral component neutral component purified purified N/A 3937762 enzyme target enzyme target substrate substrate neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false BHQ quencher dye labelled dye label dye labelled certain certain sequence position certain certain certain sequence position certain false synthetic construct synthetic construct N/A 3937763 ancillary ancillary neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3937764 enzyme target enzyme target substrate substrate neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false 5' label cy3 label cy3 label certain certain sequence position certain certain certain sequence position certain false synthetic construct synthetic construct 3937810 3937806 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false 7 A/B SARS-Nsp12 and MERS-Nsp12 can enhance the unwinding activity of SARS-Nsp13. 5'_3' long strand dna_2-5'_3' short strand dna-4 3937755 N/A 3937761 enzyme enzyme neutral component neutral component purified purified ecoli Escherichia coli (strain K12) N/A 3937766 stimulator stimulator neutral component neutral component purified purified N/A 3937762 enzyme target enzyme target substrate substrate neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false BHQ quencher dye labelled dye label dye labelled certain certain sequence position certain certain certain sequence position certain false synthetic construct synthetic construct N/A 3937763 ancillary ancillary neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3937764 enzyme target enzyme target substrate substrate neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false 5' label cy3 label cy3 label certain certain sequence position certain certain certain sequence position certain false synthetic construct synthetic construct 3937820 3937816 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false 7 A/B SARS-Nsp12 and MERS-Nsp12 can enhance the unwinding activity of SARS-Nsp13. atp-rep-3 3937756 N/A 3937761 enzyme enzyme neutral component neutral component purified purified P0C6X7-PRO_0000037319:p.Lys288Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.Ser289Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.Asp374Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.Glu375Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.Gln404Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.Arg567Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 3937767 ancillary ancillary neutral component neutral component synthetic construct synthetic construct N/A 3937763 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) atpase reaction atpase reaction false false false 3937756 1C, 2 B/C, 7 C/D W.T. Vmax =0.5 uM/min Initial velocities for WT and mutants: 0.40 uM/s (WT-Nsp13), 0.19 uM/s (K288A), 0.19 uM/s (S289A), 0.17 uM/s (D374A), 0.18 uM/s (E375A), 0.17 uM/s (Q404A) and 0.17 uM/s (R567A). atp-rep-5 3937756 N/A 3937765 stimulator stimulator neutral component neutral component purified purified N/A 3937761 enzyme enzyme neutral component neutral component purified purified ecoli Escherichia coli (strain K12) N/A 3937767 ancillary ancillary neutral component neutral component synthetic construct synthetic construct N/A 3937763 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) atpase reaction atpase reaction false false false 7 C/D Reaction velocities:- 0.24uM/s (SARS-Nsp13), 0.36uM/s (SARS-Nsp13 plus SARS-Nsp12). atp-rep-6 3937756 N/A 3937766 stimulator stimulator neutral component neutral component purified purified N/A 3937761 enzyme enzyme neutral component neutral component purified purified ecoli Escherichia coli (strain K12) N/A 3937767 ancillary ancillary neutral component neutral component synthetic construct synthetic construct N/A 3937763 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) atpase reaction atpase reaction false false false 7 C/D Reaction velocities:- 0.24uM/s (SARS-Nsp13), 0.34uM/s (SARS-Nsp13 plus MERS-Nsp12). rep-ssdna_dt25-1 3937757 N/A 3937761 unspecified role unspecified role neutral component neutral component purified purified binding region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false binding region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false binding region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false binding region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 3937767 unspecified role unspecified role neutral component neutral component synthetic construct synthetic construct direct interaction direct interaction false false false Supp. figure 4 rep-rep-141 3937757 N/A 3937761 unspecified role unspecified role neutral component neutral component purified purified binding region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false binding region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false binding region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false binding region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 3937765 unspecified role unspecified role neutral component neutral component direct interaction direct interaction false false false Supp. figure 7 atp-rep-4 3937758 N/A 3937761 enzyme enzyme neutral component neutral component purified purified ecoli Escherichia coli (strain K12) N/A 3937768 enzyme target enzyme target substrate substrate neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false synthetic construct synthetic construct N/A 3937763 ancillary ancillary neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 3937764 enzyme target enzyme target substrate substrate neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false 3' label cy3 label cy3 label certain certain sequence position certain certain certain sequence position certain false synthetic construct synthetic construct 3937862 3937859 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false 1D 5'_3' long strand dna_2-5'_3' short strand dna-5 3937759 N/A 3937761 unspecified role unspecified role neutral component neutral component P0C6X7-PRO_0000037319:p.[Asn179Ala;Arg212Ala] mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.[Arg337Ala;Arg339Ala] mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.[Lys345Ala;Lys347Ala] mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.Arg507_Lys508delinsAlaAla mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.[Lys524Ala;Gln531Ala] mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false P0C6X7-PRO_0000037319:p.[Ser539Ala;Tyr541Ala] mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 3937762 unspecified role unspecified role neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false synthetic construct synthetic construct N/A 3937764 unspecified role unspecified role neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false synthetic construct synthetic construct 3937875 3937873 physical association physical association false false false 4B atp-rep-7 3937760 N/A 3937765 unspecified role unspecified role bait bait purified purified N/A 3937761 unspecified role unspecified role prey prey purified purified ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false 3937760 7 E