IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ yan-2005-15 human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Yan X., Hao Q., Mu Y., Timani KA., Ye L., Zhu Y., Wu J. Virus - Publications including interactions involving viral proteins wu9988@vip.sina.com The international journal of biochemistry & cell biology 2005 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus yan-2005-14 in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Yan X., Hao Q., Mu Y., Timani KA., Ye L., Zhu Y., Wu J. Virus - Publications including interactions involving viral proteins wu9988@vip.sina.com The international journal of biochemistry & cell biology 2005 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus ncap_sars Nucleoprotein N 9a Nucleocapsid protein protein protein sars-cov Human SARS coronavirus SARS-CoV Severe acute respiratory syndrome coronavirus MSDNGPQSNQRSAPRITFGGPTDSTDNNQNGGRNGARPKQRRPQGLPNNTASWFTALTQHGKEELRFPRGQGVPINTNSGPDDQIGYYRRATRRVRGGDGKMKELSPRWYFYYLGTGPEASLPYGANKEGIVWVATEGALNTPKDHIGTRNPNNNAATVLQLPQGTTLPKGFYAEGSRGGSQASSRSSSRSRGNSRNSTPGSSRGNSPARMASGGGETALALLLLDRLNQLESKVSGKGQQQQGQTVTKKSAAEASKKPRQKRTATKQYNVTQAFGRRGPEQTQGNFGDQDLIRQGTDYKHWPQIAQFAPSASAFFGMSRIGMEVTPSGTWLTYHGAIKLDDKDPQFKDNVILLNKHIDAYKTFPPTEPKKDKKKKTDEAQPLPQRQKKQPTVTLLPAADMDDFSRQLQNSMSGASADSTQA mint Major structural component of virions that associates with genomic RNA to form a long, flexible, helical nucleocapsid pgh2_human_gene PTGS2/COX2/Prostaglandin G/H synthase 2 gene gene human Homo sapiens Human pgh2_human_gene-n-6 3731026 N/A 3731028 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed n-terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false N/A 3731029 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level CP1 region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Chr:1 186680904-186680927 (reverse strand) physical association physical association false false false Fig. 4a n-pgh2_human_gene-2 3731026 N/A 3731028 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed n-terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false N/A 3731029 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level NF-kB-CP1 region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Chr:1 186680649-186680668 (reverse strand) physical association physical association false false false Fig. 4b n-pgh2_human_gene-3 3731026 N/A 3731028 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed n-terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false N/A 3731029 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level C/EBP enhancer region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false Chr:1 186680559 to 186680580 (reverse strand) physical association physical association false false false Fig. 4c pgh2_human_gene-n-4 3731027 N/A 3731028 unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep over-expressed over expressed level over-expressed n-terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. N/A 3731029 unspecified role unspecified role bait bait C/EBP element sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false 5'TTACGCAA3' Chr 1:186680549-186680556 (reverse strand) region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false physical association physical association false false false Fig. 3a (lane 6) pgh2_human_gene-n-5 3731027 N/A 3731028 unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep over-expressed over expressed level over-expressed n-terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. N/A 3731029 unspecified role unspecified role bait bait NF-kB2 element sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false AGAGTGGGGACTACCCCCTCTGCTC Chr 1: 186680629-186680653 (reverse strand) region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false physical association physical association false false false Fig. 3b (lane 6)