HPIDb Host Pathogen Interaction database http://www.agbase.msstate.edu/hpi/main.html http://www.agbase.msstate.edu/hpi/main.html khu-2001-1 Mutations that affect dimer formation and helicase activity of the hepatitis C virus helicase. yeast Saccharomyces cerevisiae Baker's yeast 2 hybrid two hybrid 2H 2h Gal4 transcription regeneration two-hybrid yeast two hybrid 2-hybrid classical two hybrid classical two hybrid 2H two-hybrid 2-hybrid Gal4 transcription regeneration 2h yeast two hybrid Y2H Y-2H 2 hybrid predetermined predetermined participant predetermined Khu Y.L., Koh E., Lim S.P., Tan Y.H., Brenner S., Lim S.G., Hong W.J., Goh P.Y. Virus - Publications including interactions involving viral proteins mcbgohpy@imcb.nus.edu.sg J. Virol. (0022-538X) 2001 imex curation Only protein-protein interactions imex curation khu-2001-2 Mutations that affect dimer formation and helicase activity of the hepatitis C virus helicase. chlae-cv-1 Monkey African Green kidney fibroblast Grivet cv-1 Monkey African Green kidney fibroblast anti tag coip anti tag coimmunoprecipitation anti tag coip anti tag western anti tag western blot anti tag western Khu Y.L., Koh E., Lim S.P., Tan Y.H., Brenner S., Lim S.G., Hong W.J., Goh P.Y. Virus - Publications including interactions involving viral proteins mcbgohpy@imcb.nus.edu.sg J. Virol. (0022-538X) 2001 imex curation Only protein-protein interactions imex curation khu-2001-3 Mutations that affect dimer formation and helicase activity of the hepatitis C virus helicase. in vitro In vitro molecular sieving molecular sieving Gel Filtration Size Exclusion Chromatography Size Exclusion Chromatography Gel Filtration Sizing column western blot western blot Immuno blot Immuno blot Khu Y.L., Koh E., Lim S.P., Tan Y.H., Brenner S., Lim S.G., Hong W.J., Goh P.Y. Virus - Publications including interactions involving viral proteins mcbgohpy@imcb.nus.edu.sg J. Virol. (0022-538X) 2001 imex curation Only protein-protein interactions imex curation khu-2001-4 Mutations that affect dimer formation and helicase activity of the hepatitis C virus helicase. in vitro In vitro enzymatic study enzymatic study autoradiography autoradiography Khu Y.L., Koh E., Lim S.P., Tan Y.H., Brenner S., Lim S.G., Hong W.J., Goh P.Y. Virus - Publications including interactions involving viral proteins mcbgohpy@imcb.nus.edu.sg J. Virol. (0022-538X) 2001 imex curation Only protein-protein interactions imex curation p27958-pro_0000037573 Serine protease/helicase NS3 protein protein HCV77 Hepatitis C virus genotype 1a (isolate H77) APITAYAQQTRGLLGCIITSLTGRDKNQVEGEVQIVSTATQTFLATCINGVCWTVYHGAGTRTIASPKGPVIQTYTNVDQDLVGWPAPQGSRSLTPCTCGSSDLYLVTRHADVIPVRRRGDSRGSLLSPRPISYLKGSSGGPLLCPTGHAVGLFRAAVCTRGVAKAVDFIPVENLETTMRSPVFTDNSSPPAVPQSFQVAHLHAPTGSGKSTKVPAAYAAKGYKVLVLNPSVAATLGFGAYMSKAHGVDPNIRTGVRTITTGSPITYSTYGKFLADAGCSGGAYDIIICDECHSTDATSISGIGTVLDQAETAGARLVVLATATPPGSVTVSHPNIEEVALSTTGEIPFYGKAIPLEVIKGGRHLIFCHSKKKCDELAAKLVALGINAVAYYRGLDVSVIPTSGDVVVVSTDALMTGFTGDFDSVIDCNTCVTQTVDFSLDPTFTIETTTLPQDAVSRTQRRGRTGRGKPGIYRFVAPGERPSGMFDSSVLCECYDAGCAWYELTPAETTVRLRAYMNTPGLPVCQDHLGFWEGVFTGLTHIDAHFLSQTKQSGENFPYLVAYQATVCARAQAPPPSWDQMRKCLIRLKPTLHGPTPLLYRLGAVQNEVTLTHPITKYIMTCMSADLEVVT 1027 1657 olg39 39-mer oligonucleotide nucleic acid nucleic acid hcvh Hepatitis C virus genotype 1a (isolate H) (HCV) ATAATGTGTGCTGCCTGCCACTCAACTGACTCAACT olg54_olg55 Double-stranded oligodeoxynucleotide olg54_olg55 ds dna double stranded deoxyribonucleic acid ds DNA ds dna chemical synthesis Chemical synthesis (Chemical synthesis) GTCAGTTGAGTGGCAGGCGGCACACATTATAGTGTCGTAGGCTTC p27958_pro-p27958_pro-4 1459415 n/a NS3 1459419 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false P27958-PRO_0000037573:p.Ile288Thr mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false P27958-PRO_0000037573:p.Thr266Ala mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false P27958-PRO_0000037573:p.Ser268Pro mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain false P27958-PRO_0000037573:p.Tyr267Ser mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false P27958-PRO_0000037573:p.Thr269Ala mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain false n/a NS3 1459419 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false 1459431 1459424 physical association physical association false false false Fig. 1A, 2A and 5 ns3 dimer-1 1459416 n/a NS3 1459419 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false flag tag flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a NS3 1459419 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false myc tag myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false 1459437 1459434 physical association physical association false false false Fig. 1B and 2B p27958_pro-p27958_pro-1 1459417 n/a NS3 1459419 unspecified role unspecified role neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false P27958-PRO_0000037573:p.Ile288Thr mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false P27958-PRO_0000037573:p.Thr266Ala mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false P27958-PRO_0000037573:p.Tyr267Ser mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain false Stoichiometry: 2.0 n/a 1459420 stimulator stimulator unspecified role unspecified role physical association physical association false false false Fig. 3 and 4B When 39-mer oligonucleotide (OLG39: 39ATAATGTGTGCTGCCTGCCACTCAACTGACTCAACT59) was added, NS3 formed a dimer. ns3-olg54_olg54-1 1459418 n/a NS3 1459419 enzyme enzyme neutral component neutral component P27958-PRO_0000037573:p.Tyr267Ser mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false P27958-PRO_0000037573:p.Ile288Thr mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false P27958-PRO_0000037573:p.Thr266Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false n/a 1459421 enzyme target enzyme target substrate substrate neutral component neutral component enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction false false false Fig. 6 double-stranded oligodeoxynucleotide used as a substrate