IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ cao-2014-1 Activation of STAT3 stimulates AHSP expression in K562 cells. human-k_562 Homo sapiens myeloid leukemia cells. k562 Myelogenous leukemia K562 cells ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Cao C., Zhao G., Yu W., Xie X., Wang W., Yang R., Lv X., Liu D. IBD - Inflammatory bowel disease liudp@ pumc.edu.cn,lvxiang@pumc.edu.cn Sci China Life Sci (1674-7305) 2014 Only protein-protein interactions imex curation cao-2014-3 Activation of STAT3 stimulates AHSP expression in K562 cells. human-k_562 Homo sapiens myeloid leukemia cells. k562 Myelogenous leukemia K562 cells ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Cao C., Zhao G., Yu W., Xie X., Wang W., Yang R., Lv X., Liu D. IBD - Inflammatory bowel disease This experiment was performed with a stable K562 cell line overexpressing human alpha-globin (HBA). liudp@ pumc.edu.cn,lvxiang@pumc.edu.cn Sci China Life Sci (1674-7305) 2014 Only protein-protein interactions imex curation cao-2014-2 Activation of STAT3 stimulates AHSP expression in K562 cells. in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift anti tag immunost anti tag immunostaining anti tag immunost Cao C., Zhao G., Yu W., Xie X., Wang W., Yang R., Lv X., Liu D. IBD - Inflammatory bowel disease Nuclear extracts were prepared from electrophile tert-butylhydroquinone (tBHQ)-treated (20 micromolar/liter for 6 hours) K562 cells. liudp@ pumc.edu.cn,lvxiang@pumc.edu.cn Sci China Life Sci (1674-7305) 2014 Only protein-protein interactions imex curation stat3_human Signal transducer and activator of transcription 3 Acute-phase response factor STAT3 APRF protein protein human Homo sapiens Human MAQWNQLQQLDTRYLEQLHQLYSDSFPMELRQFLAPWIESQDWAYAASKESHATLVFHNLLGEIDQQYSRFLQESNVLYQHNLRRIKQFLQSRYLEKPMEIARIVARCLWEESRLLQTAATAAQQGGQANHPTAAVVTEKQQMLEQHLQDVRKRVQDLEQKMKVVENLQDDFDFNYKTLKSQGDMQDLNGNNQSVTRQKMQQLEQMLTALDQMRRSIVSELAGLLSAMEYVQKTLTDEELADWKRRQQIACIGGPPNICLDRLENWITSLAESQLQTRQQIKKLEELQQKVSYKGDPIVQHRPMLEERIVELFRNLMKSAFVVERQPCMPMHPDRPLVIKTGVQFTTKVRLLVKFPELNYQLKIKVCIDKDSGDVAALRGSRKFNILGTNTKVMNMEESNNGSLSAEFKHLTLREQRCGNGGRANCDASLIVTEELHLITFETEVYHQGLKIDLETHSLPVVVISNICQMPNAWASILWYNMLTNNPKNVNFFTKPPIGTWDQVAEVLSWQFSSTTKRGLSIEQLTTLAEKLLGPGVNYSGCQITWAKFCKENMAGKGFSFWVWLDNIIDLVKKYILALWNEGYIMGFISKERERAILSTKPPGTFLLRFSESSKEGGVTFTWVEKDISGKTQIQSVEPYTKQQLNNMSFAEIIMGYKIMDATNILVSPLVYLYPDIPKEEAFGKYCRPESQEHPEADPGSAAPYLKTKFICVTPTTCSNTIDLPMSPRTLDSLMQFGNNGEGAEPSAGGQFESLTFDMELTSECATSPM 6C00632211C8012D ahsp_human_gene Alpha-hemoglobin-stabilizing protein (AHSP) Human gene gene gene human Homo sapiens Human ahsp_human_sb3-site_dna-probe Human AHSP gene promoter SB3 site DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human TCTCCTCCCTAGAATGACCTATCACCCTCCTTCAGGACCT nf2l2_human Nuclear factor erythroid 2-related factor 2 NFE2L2 NRF2 Nuclear factor, erythroid derived 2, like 2 HEBP1 protein protein human Homo sapiens Human MMDLELPPPGLPSQQDMDLIDILWRQDIDLGVSREVFDFSQRRKEYELEKQKKLEKERQEQLQKEQEKAFFAQLQLDEETGEFLPIQPAQHIQSETSGSANYSQVAHIPKSDALYFDDCMQLLAQTFPFVDDNEVSSATFQSLVPDIPGHIESPVFIATNQAQSPETSVAQVAPVDLDGMQQDIEQVWEELLSIPELQCLNIENDKLVETTMVPSPEAKLTEVDNYHFYSSIPSMEKEVGNCSPHFLNAFEDSFSSILSTEDPNQLTVNSLNSDATVNTDFGDEFYSAFIAEPSISNSMPSPATLSHSLSELLNGPIDVSDLSLCKAFNQNHPESTAEFNDSDSGISLNTSPSVASPEHSVESSSYGDTLLGLSDSEVEELDSAPGSVKQNGPKTPVHSSGDMVQPLSPSQGQSTHVHDAQCENTPEKELPVSPGHRKTPFTKDKHSSRLEAHLTRDELRAKALHIPFPVEKIINLPVVDFNEMMSKEQFNEAQLALIRDIRRRGKNKVAAQNCRKRKLENIVELEQDLDHLKDEKEKLLKEKGENDKSLHLLKKQLSTLYLEVFSMLRDEDGKPYSPSEYSLQQTRDGNVFLVPKSKKPDVKKN stat3-ahsp-4 1574928 n/a 1574931 unspecified role unspecified role bait bait possible phosphotyr-705 optyr O4'-phospho-L-tyrosine (2S)-2-amino-3-(4-phosphonooxyphenyl)propanoic acid 2-azanyl-3-(4-phosphonooxyphenyl)propanoic acid MOD_RES Phosphotyrosine O4-phosphotyrosine tyrosine phosphate 2-amino-3-(4-hydroxyphenyl)propanoic acid 4'-phosphate O4'-phospho-L-tyrosine O4'-phosphorylated L-tyrosine OPTyr Phospho Phospho Tyrosinyl Phosphorylation phosphorylationy certain certain sequence position certain certain certain sequence position certain false n/a 1574932 unspecified role unspecified role prey prey promoter region stat3-binding site sb2 binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false Fig. 2b interleukin 6 (IL6) P40763 increases expression at RNA level of ENSG00000169877 P40763 increases expression at protein level of ENSG00000169877 stat3-ahsp-2 1574928 n/a 1574932 unspecified role unspecified role prey prey promoter region stat3-binding site sb3 binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1574931 unspecified role unspecified role bait bait phosphotyr-705 optyr O4'-phospho-L-tyrosine (2S)-2-amino-3-(4-phosphonooxyphenyl)propanoic acid 2-azanyl-3-(4-phosphonooxyphenyl)propanoic acid MOD_RES Phosphotyrosine O4-phosphotyrosine tyrosine phosphate 2-amino-3-(4-hydroxyphenyl)propanoic acid 4'-phosphate O4'-phospho-L-tyrosine O4'-phosphorylated L-tyrosine OPTyr Phospho Phospho Tyrosinyl Phosphorylation phosphorylationy certain certain sequence position certain certain certain sequence position certain false association association false false false Fig. 2b stat3-ahsp-1 1574929 n/a 1574932 unspecified role unspecified role prey prey promoter region stat3-binding site sb2 binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1574931 unspecified role unspecified role bait bait association association false false false Fig. 2c P40763 increases expression at RNA level of ENSG00000169877 P40763 increases expression at protein level of ENSG00000169877 stat3-ahsp-3 1574929 n/a 1574932 unspecified role unspecified role prey prey promoter region stat3-binding site sb3 binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1574931 unspecified role unspecified role bait bait phosphotyr-705 optyr O4'-phospho-L-tyrosine (2S)-2-amino-3-(4-phosphonooxyphenyl)propanoic acid 2-azanyl-3-(4-phosphonooxyphenyl)propanoic acid MOD_RES Phosphotyrosine O4-phosphotyrosine tyrosine phosphate 2-amino-3-(4-hydroxyphenyl)propanoic acid 4'-phosphate O4'-phospho-L-tyrosine O4'-phosphorylated L-tyrosine OPTyr Phospho Phospho Tyrosinyl Phosphorylation phosphorylationy certain certain sequence position certain certain certain sequence position certain false phosphotyr-705 association association false false false Fig. 2c P40763 increases expression at RNA level of ENSG00000169877 P40763 increases expression at protein level of ENSG00000169877 ahsp-nfe2l2-1 1574930 n/a 1574933 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1574934 unspecified role unspecified role prey prey human-k_562 Homo sapiens myeloid leukemia cells. k562 Myelogenous leukemia K562 cells physical association physical association false false false Fig. 3c