IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ miyata-2014-1 in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa autoradiography autoradiography Miyata M., Hata T., Yamazoe Y., Yoshinari K. IBD - Inflammatory bowel disease mmiyata@fish-u.ac.jp Biochemical and biophysical research communications 2014 imex curation Only protein-protein interactions miyata-2014-2 human-ls147t Homo sapiens ls147t Human colon adenocarcinoma LS147T cells ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Miyata M., Hata T., Yamazoe Y., Yoshinari K. IBD - Inflammatory bowel disease mmiyata@fish-u.ac.jp Biochemical and biophysical research communications 2014 imex curation Only protein-protein interactions miyata-2014-3 in vitro In vitro pull down pull down western blot western blot Immuno blot Immuno blot Miyata M., Hata T., Yamazoe Y., Yoshinari K. IBD - Inflammatory bowel disease mmiyata@fish-u.ac.jp Biochemical and biophysical research communications 2014 imex curation Only protein-protein interactions fxr_re_probe_ir1_motif_fgf19_gene FXR-responsive element-IR-1 motif in the second intron of the FGF19 gene dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human CCTGCAGTTCAGTGACCTTTGCA rxra_human Retinoic acid receptor RXR-alpha RXRA NR2B1 Retinoid X receptor alpha Nuclear receptor subfamily 2 group B member 1 protein protein human Homo sapiens Human MDTKHFLPLDFSTQVNSSLTSPTGRGSMAAPSLHPSLGPGIGSPGQLHSPISTLSSPINGMGPPFSVISSPMGPHSMSVPTTPTLGFSTGSPQLSSPMNPVSSSEDIKPPLGLNGVLKVPAHPSGNMASFTKHICAICGDRSSGKHYGVYSCEGCKGFFKRTVRKDLTYTCRDNKDCLIDKRQRNRCQYCRYQKCLAMGMKREAVQEERQRGKDRNENEVESTSSANEDMPVERILEAELAVEPKTETYVEANMGLNPSSPNDPVTNICQAADKQLFTLVEWAKRIPHFSELPLDDQVILLRAGWNELLIASFSHRSIAVKDGILLATGLHVHRNSAHSAGVGAIFDRVLTELVSKMRDMQMDKTELGCLRAIVLFNPDSKGLSNPAEVEALREKVYASLEAYCKHKYPEQPGRFAKLLLRLPALRSIGLKCLEHLFFFKLIGDTPIDTFLMEMLEAPHQMT nr1h4_human Bile acid receptor NR1H4 BAR FXR HRR1 RIP14 Farnesoid X-activated receptor Farnesol receptor HRR-1 Nuclear receptor subfamily 1 group H member 4 Retinoid X receptor-interacting protein 14 protein protein human Homo sapiens Human MVMQFQGLENPIQISPHCSCTPSGFFMEMMSMKPAKGVLTEQVAGPLGQNLEVEPYSQYSNVQFPQVQPQISSSSYYSNLGFYPQQPEEWYSPGIYELRRMPAETLYQGETEVAEMPVTKKPRMGASAGRIKGDELCVVCGDRASGYHYNALTCEGCKGFFRRSITKNAVYKCKNGGNCVMDMYMRRKCQECRLRKCKEMGMLAECMYTGLLTEIQCKSKRLRKNVKQHADQTVNEDSEGRDLRQVTSTTKSCREKTELTPDQQTLLHFIMDSYNKQRMPQEITNKILKEEFSAEENFLILTEMATNHVQVLVEFTKKLPGFQTLDHEDQIALLKGSAVEAMFLRSAEIFNKKLPSGHSDLLEERIRNSGISDEYITPMFSFYKSIGELKMTQEEYALLTAIVILSPDRQYIKDREAVEKLQEPLLDVLQKLCKIHQPENPQHFACLLGRLTELRTFNHHHAEMLMSWRVNDHKFTPLLCEIWDVQ srbp2_human Sterol regulatory element-binding protein 2 SREBF2 SREBP2 Sterol regulatory element-binding transcription factor 2 BHLHD2 Class D basic helix-loop-helix protein 2 protein protein human Homo sapiens Human MDDSGELGGLETMETLTELGDELTLGDIDEMLQFVSNQVGEFPDLFSEQLCSSFPGSGGSGSSSGSSGSSSSSSNGRGSSSGAVDPSVQRSFTQVTLPSFSPSAASPQAPTLQVKVSPTSVPTTPRATPILQPRPQPQPQPQTQLQQQTVMITPTFSTTPQTRIIQQPLIYQNAATSFQVLQPQVQSLVTSSQVQPVTIQQQVQTVQAQRVLTQTANGTLQTLAPATVQTVAAPQVQQVPVLVQPQIIKTDSLVLTTLKTDGSPVMAAVQNPALTALTTPIQTAALQVPTLVGSSGTILTTMPVMMGQEKVPIKQVPGGVKQLEPPKEGERRTTHNIIEKRYRSSINDKIIELKDLVMGTDAKMHKSGVLRKAIDYIKYLQQVNHKLRQENMVLKLANQKNKLLKGIDLGSLVDNEVDLKIEDFNQNVLLMSPPASDSGSQAGFSPYSIDSEPGSPLLDDAKVKDEPDSPPVALGMVDRSRILLCVLTFLCLSFNPLTSLLQWGGAHDSDQHPHSGSGRSVLSFESGSGGWFDWMMPTLLLWLVNGVIVLSVFVKLLVHGEPVIRPHSRSSVTFWRHRKQADLDLARGDFAAAAGNLQTCLAVLGRALPTSRLDLACSLSWNVIRYSLQKLRLVRWLLKKVFQCRRATPATEAGFEDEAKTSARDAALAYHRLHQLHITGKLPAGSACSDVHMALCAVNLAECAEEKIPPSTLVEIHLTAAMGLKTRCGGKLGFLASYFLSRAQSLCGPEHSAVPDSLRWLCHPLGQKFFMERSWSVKSAAKESLYCAQRNPADPIAQVHQAFCKNLLERAIESLVKPQAKKKAGDQEEESCEFSSALEYLKLLHSFVDSVGVMSPPLSRSSVLKSALGPDIICRWWTSAITVAISWLQGDDAAVRSHFTKVERIPKALEVTESPLVKAIFHACRAMHASLPGKADGQQSSFCHCERASGHLWSSLNVSGATSDPALNHVVQLLTCDLLLSLRTALWQKQASASQAVGETYHASGAELAGFQRDLGSLRRLAHSFRPAYRKVFLHEATVRLMAGASPTRTHQLLEHSLRRRTTQSTKHGEVDAWPGQRERATAILLACRHLPLSFLSSPGQRAVLLAEAARTLEKVGDRRSCNDCQQMIVKLGGGTAIAAS sre_probe_human_ldlr_gene_promoter sterol regulatory element (SRE) motif from promoter region of human LDLR gene dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human GAAAATCACCCCACTGCAAA fgf19_human_gene Fibroblast growth factor 19 FGF19 gene gene human Homo sapiens Human fxr_re probe_ir1_motif_fgf19_gene-nr1h4-1 1853243 N/A 1853246 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 1853247 unspecified role unspecified role prey prey in vitro In vitro N/A 1853248 unspecified role unspecified role prey prey in vitro In vitro physical association physical association false false false 3 B/C fxr_re probe_ir1_motif_fgf19_gene-nr1h4-2 1853243 N/A 1853249 inhibitor inhibitor prey prey in vitro In vitro N/A 1853246 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 1853247 unspecified role unspecified role prey prey in vitro In vitro N/A 1853248 unspecified role unspecified role prey prey in vitro In vitro physical association physical association false false false 3Bi The SREBP-2-mediated reduction in binding disappeared when the amount of FXR, but not RXRa, was increased. sre_probe_human_ldlr_gene_promoter-1 1853243 N/A 1853249 unspecified role unspecified role prey prey in vitro In vitro N/A 1853250 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction false false false 3C nr1h4-fgf19-1 1853244 N/A 1853251 unspecified role unspecified role prey prey fxre_region_intron_2 sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 1853248 unspecified role unspecified role bait bait association association false false false 3E cholesterol (CHEBI:16113) and 25-hydroxycholesterol (CHEBI:42977). CHEBI:16113 and CHEBI:42977 increases binding of Q96RI1 to ENSG00000162344. CHEBI:16113 and CHEBI:42977 decreases expression at protein level of ENSG00000198911. CHEBI:16113 and CHEBI:42977 increases expression at RNA level of ENSG00000162344. Q12772 decreases expression at RNA level of ENSG00000162344 GW4064 (CHEBI:79997) is a non-steroidal agonist of the nuclear receptor FXR. CHEBI:79997 increases expression at RNA level of ENSG00000162344 Q12772 decreases activity of CHEBI:79997 srebf2-nr1h4-1 1853245 N/A 1853248 unspecified role unspecified role prey prey in vitro In vitro N/A 1853249 unspecified role unspecified role bait bait n_terminus gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) physical association physical association false false false 4