IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ diegelmann-2012-1 in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift tag visualisation tag visualisation Diegelmann J., Czamara D., Le Bras E., Zimmermann E., Olszak T., Bedynek A., Göke B., Franke A., Glas J., Brand S. Crohn's disease - Interactions of proteins identified as having a link to Crohn's disease stephan.brand@med.uni-muenchen.de PloS one 2012 Only protein-protein interactions imex curation imex curation IBD - Inflammatory bowel disease dmbt1_probe_ rs2981804_allele_a probe from SNP rs2981804 risk allele A ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human CCTGCTAACGTAACCAAATTGCTA atf2_human Cyclic AMP-dependent transcription factor ATF-2 ATF2 CREB2 CREBP1 Activating transcription factor 2 cAMP response element-binding protein CRE-BP1 HB16 Cyclic AMP-responsive element-binding protein 2 protein protein human Homo sapiens Human MKFKLHVNSARQYKDLWNMSDDKPFLCTAPGCGQRFTNEDHLAVHKHKHEMTLKFGPARNDSVIVADQTPTPTRFLKNCEEVGLFNELASPFENEFKKASEDDIKKMPLDLSPLATPIIRSKIEEPSVVETTHQDSPLPHPESTTSDEKEVPLAQTAQPTSAIVRPASLQVPNVLLTSSDSSVIIQQAVPSPTSSTVITQAPSSNRPIVPVPGPFPLLLHLPNGQTMPVAIPASITSSNVHVPAAVPLVRPVTMVPSVPGIPGPSSPQPVQSEAKMRLKAALTQQHPPVTNGDTVKGHGSGLVRTQSEESRPQSLQQPATSTTETPASPAHTTPQTQSTSGRRRRAANEDPDEKRRKFLERNRAAASRCRQKRKVWVQSLEKKAEDLSSLNGQLQSEVTLLRNEVAQLKQLLLAHKDCPVTAMQKKSGYHTADKDDSSEDISVPSSPHTEAIQHSSVSTSNGVSSTSKAEAVATSVLTQMADQSTEPALSQIVMAPSSQSQPSGS creb1_human Cyclic AMP-responsive element-binding protein 1 CREB1 protein protein human Homo sapiens Human MTMESGAENQQSGDAAVTEAENQQMTVQAQPQIATLAQVSMPAAHATSSAPTVTLVQLPNGQTVQVHGVIQAAQPSVIQSPQVQTVQISTIAESEDSQESVDSVTDSQKRREILSRRPSYRKILNDLSSDAPGVPRIEEEKSEEETSAPAITTVTVPTPIYQTSSGQYIAITQGGAIQLANNGTDGVQGLQTLTMTNAAATQPGTTILQYAQTTDGQQILVPSNQVVVQAASGDVQTYQIRTAPTSTIAPGVVMASSPALPTQPAEEAARKREVRLMKNREAARECRRKKKEYVKCLENRVAVLENQNKTLIEELKALKDLYCHKSD creb1_probe ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human AGAGATTGCCTGACGTCAGAGAGCTAG dmbt1_probe_ rs2981804_allele_a-atf2-1 1853072 N/A 1853073 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 1853074 unspecified role unspecified role prey prey human-dld1 Human colorectal adenocarcinoma dld1 Human colon adenocarcinoma physical association physical association false false false 4B dmbt1_probe_ rs2981804_allele_a-creb1-1 1853072 N/A 1853073 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 1853075 unspecified role unspecified role prey prey human-dld1 Human colorectal adenocarcinoma dld1 Human colon adenocarcinoma physical association physical association false false false 4Bi dmbt1_probe_ rs2981804_allele_a-creb1-2 1853072 N/A 1853076 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 1853075 unspecified role unspecified role prey prey human-dld1 Human colorectal adenocarcinoma dld1 Human colon adenocarcinoma physical association physical association false false false 4C