IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ renga-2013-1 in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift tag visualisation tag visualisation Renga B., D'Amore C., Cipriani S., Mencarelli A., Carino A., Sepe V., Zampella A., Distrutti E., Fiorucci S. IBD - Inflammatory bowel disease barbara.renga@unipg.it Pharmacological research : the official journal of the Italian Pharmacological Society 2013 Only protein-protein interactions imex curation imex curation renga-2013-2 mouse-raw264_7 Mus musculus monocyte macrophage cell line RAW264 raw264_7 Mouse monocyte macrophage cellline RAW264.7 ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Renga B., D'Amore C., Cipriani S., Mencarelli A., Carino A., Sepe V., Zampella A., Distrutti E., Fiorucci S. IBD - Inflammatory bowel disease barbara.renga@unipg.it Pharmacological research : the official journal of the Italian Pharmacological Society 2013 Only protein-protein interactions imex curation imex curation renga-2013-3 mouse-raw264_7 Mus musculus monocyte macrophage cell line RAW264 raw264_7 Mouse monocyte macrophage cellline RAW264.7 chip-3c chromosome conformation capture assay chip-3c q-pcr quantitative pcr q-pcr Renga B., D'Amore C., Cipriani S., Mencarelli A., Carino A., Sepe V., Zampella A., Distrutti E., Fiorucci S. IBD - Inflammatory bowel disease barbara.renga@unipg.it Pharmacological research : the official journal of the Italian Pharmacological Society 2013 Only protein-protein interactions imex curation imex curation nr1h4_mouse Bile acid receptor Farnesoid X-activated receptor Farnesol receptor HRR-1 Nuclear receptor subfamily 1 group H member 4 Retinoid X receptor-interacting protein 14 Nr1h4 Bar Fxr Rip14 protein protein mouse Mus musculus Mouse MVMQFQGLENPIQISLHHSHRLSGFVPEGMSVKPAKGMLTEHAAGPLGQNLDLESYSPYNNVPFPQVQPQISSSSYYSNLGFYPQQPEDWYSPGIYELRRMPAETGYQGETEVSEMPVTKKPRMAAASAGRIKGDELCVVCGDRASGYHYNALTCEGCKGFFRRSITKNAVYKCKNGGNCVMDMYMRRKCQECRLRKCKEMGMLAECMYTGLLTEIQCKSKRLRKNVKQHADQTANEDDSEGRDLRQVTSTTKFCREKTELTADQQTLLDYIMDSYNKQRMPQEITNKILKEEFSAEENFLILTEMATSHVQILVEFTKKLPGFQTLDHEDQIALLKGSAVEAMFLRSAEIFNKKLPAGHADLLEERIRKSGISDEYITPMFSFYKSVGELKMTQEEYALLTAIVILSPDRQYIKDREAVEKLQEPLLDVLQKLCKMYQPENPQHFACLLGRLTELRTFNHHHAEMLMSWRVNDHKFTPLLCEIWDVQ er-8_distal_promoter_nr3c1_gene_probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid mouse Mus musculus Mouse TCAGCTGTATTTACAGGTCA nr3c1_mouse_gene Nr3c1 gene gene mouse Mus musculus Mouse er_8_distal_promoter_nr3c1_gene_probe-nr1h4-1 1876452 N/A 1876455 unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep mouse-raw264_7 Mus musculus monocyte macrophage cell line RAW264 raw264_7 Mouse monocyte macrophage cellline RAW264.7 N/A 1876456 unspecified role unspecified role bait bait purified purified region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro physical association physical association false false false 6B Using nuclear extracts from Raw264.7 cells stimulated with 6-EDCA (CHEBI:43602) increased the interaction. nr1h4-nr3c1-1 1876453 N/A 1876457 unspecified role unspecified role prey prey distal_promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A FXR 1876455 unspecified role unspecified role bait bait association association false false false 6C CHEBI:43602 / CHEMBL566315 (ECDCA) CHEBI:43602 increases the binding of Q60641 to ENSMUSG00000024431 CHEBI:43602 increases the expression at RNA level of ENSMUSG00000024431 CHEBI:41879 increases the expression at RNA level of ENSMUSG00000024431 The relative mRNA expression of Gr was significantly enhanced in cells co-stimulated with 6-ECDCA plus Dexa in comparison to cells stimulated only with 6-ECDCA or Dexa. Agonist effect of 6-ECDCA (CHEBI:43602) is detected 1 hour after exposure and it is gone after 12 hours. nr3c1-nr3c1-1 1876454 N/A 1876457 unspecified role unspecified role neutral component neutral component region_distal_promoter_including_fxre sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 1876457 unspecified role unspecified role neutral component neutral component region_proximal_promoter_including_gre sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false 7A CHEBI:41879 and CHEBI:43602 increased binding of ENSMUSG00000024431 to ENSMUSG00000024431