IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ shavva-2013-2 Hepatic nuclear factor 4α positively regulates complement C3 expression and does not interfere with TNFα-mediated stimulation of C3 expression in HepG2 cells. in vitro In vitro pull down pull down western blot western blot Immuno blot Immuno blot Shavva V.S., Mogilenko D.A., Dizhe E.B., Oleinikova G.N., Perevozchikov A.P., Orlov S.V. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis shavva@iem.sp.ru,denis@iem.sp.ru,serge@iem.sp.ru Gene (0378-1119) 2013 Only protein-protein interactions imex curation IBD - Inflammatory bowel disease shavva-2013-1 Hepatic nuclear factor 4α positively regulates complement C3 expression and does not interfere with TNFα-mediated stimulation of C3 expression in HepG2 cells. human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Shavva V.S., Mogilenko D.A., Dizhe E.B., Oleinikova G.N., Perevozchikov A.P., Orlov S.V. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis shavva@iem.sp.ru,denis@iem.sp.ru,serge@iem.sp.ru Gene (0378-1119) 2013 Only protein-protein interactions imex curation IBD - Inflammatory bowel disease hnf4a_human Hepatocyte nuclear factor 4-alpha Transcription factor HNF-4 Nuclear receptor subfamily 2 group A member 1 Transcription factor 14 HNF4A HNF4 NR2A1 TCF14 protein protein human Homo sapiens Human MRLSKTLVDMDMADYSAALDPAYTTLEFENVQVLTMGNDTSPSEGTNLNAPNSLGVSALCAICGDRATGKHYGASSCDGCKGFFRRSVRKNHMYSCRFSRQCVVDKDKRNQCRYCRLKKCFRAGMKKEAVQNERDRISTRRSSYEDSSLPSINALLQAEVLSRQITSPVSGINGDIRAKKIASIADVCESMKEQLLVLVEWAKYIPAFCELPLDDQVALLRAHAGEHLLLGATKRSMVFKDVLLLGNDYIVPRHCPELAEMSRVSIRILDELVLPFQELQIDDNEYAYLKAIIFFDPDAKGLSDPGKIKRLRSQVQVSLEDYINDRQYDSRGRFGELLLLLPTLQSITWQMIEQIQFIKLFGMAKIDNLLQEMLLGGSPSDAPHAHHPLHPHLMQEHMGTNVIVANTMPTHLSNGQMCEWPRPRGQAATPETPQPSPPGGSGSEPYKLLPGAVATIVKPLSAIPQPTITKQEVI co3_human_hnf4a-dr0_dna-probe Human CO3 gene promoter HNF4alpha binding site DR0 DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human TGCCCTGGACTCTCCCAGGGTCAGGGCCACCTGGTGAACACA co3_human_hnf4a-dr4_dna-probe Human CO3 gene promoter HNF4alpha binding site DR4 DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human TGGACTCATCCCCAGTTCACTTTTGGCCATGCGTTTATCAG co3_human_gene Complement C3 (CO3) human gene gene gene human Homo sapiens Human apoa1_human_gene Apolipoprotein A-I (APOA1) human gene gene gene human Homo sapiens Human tf65_human Transcription factor p65 Nuclear factor NF-kappa-B p65 subunit RELA NFKB3 Nuclear factor of kappa light polypeptide gene enhancer in B-cells 3 protein protein human Homo sapiens Human MDELFPLIFPAEPAQASGPYVEIIEQPKQRGMRFRYKCEGRSAGSIPGERSTDTTKTHPTIKINGYTGPGTVRISLVTKDPPHRPHPHELVGKDCRDGFYEAELCPDRCIHSFQNLGIQCVKKRDLEQAISQRIQTNNNPFQVPIEEQRGDYDLNAVRLCFQVTVRDPSGRPLRLPPVLSHPIFDNRAPNTAELKICRVNRNSGSCLGGDEIFLLCDKVQKEDIEVYFTGPGWEARGSFSQADVHRQVAIVFRTPPYADPSLQAPVRVSMQLRRPSDRELSEPMEFQYLPDTDDRHRIEEKRKRTYETFKSIMKKSPFSGPTDPRPPPRRIAVPSRSSASVPKPAPQPYPFTSSLSTINYDEFPTMVFPSGQISQASALAPAPPQVLPQAPAPAPAPAMVSALAQAPAPVPVLAPGPPQAVAPPAPKPTQAGEGTLSEALLQLQFDDEDLGALLGNSTDPAVFTDLASVDNSEFQQLLNQGIPVAPHTTEPMLMEYPEAITRLVTGAQRPPDPAPAPLGAPGLPNGLLSGDEDFSSIADMDFSALLSQISS co3-hnf4a-2 1766194 n/a 1766196 unspecified role unspecified role prey prey human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). n/a 1766197 unspecified role unspecified role bait bait 5-prime biotin tag biotin tag certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig. 1c co3-co3-2 1766194 n/a 1766197 competitor competitor competitor prey prey g18t_g19t_g24t_g25t mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1766196 unspecified role unspecified role prey prey human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). n/a 1766197 unspecified role unspecified role bait bait 5-prime biotin tag biotin tag certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) association association false false false Fig. 1c co3-hnf4a-1 1766194 n/a 1766198 unspecified role unspecified role bait bait 5-prime biotin tag biotin tag certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1766196 unspecified role unspecified role prey prey human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). physical association physical association false false false Fig. 1c co3-co3-1 1766194 n/a 1766196 unspecified role unspecified role prey prey human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). n/a 1766198 competitor competitor competitor prey prey a14t_g15t_g25t_g26t mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1766198 unspecified role unspecified role bait bait 5-prime biotin tag biotin tag certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) association association false false false Fig. 1c hnf4a-co3-1 1766195 n/a 1766199 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1766196 unspecified role unspecified role bait bait association association false false false Fig. 1b, 3a P41235 increases expression at RNA level of ENSG00000125730 human tumor necrosis factor alpha (TNF-alpha) (P01375) P01375 decreases binding of P41235 to ENSG00000125730 hnf4a-apoa1-1 1766195 n/a 1766200 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1766196 unspecified role unspecified role bait bait association association false false false Fig. 1b rela-co3-1 1766195 n/a 1766201 unspecified role unspecified role bait bait n/a 1766199 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false Fig. 2b P01375 indirectly increases expression at RNA level of ENSG00000125730