IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ motomura-2011-1 mouse-t-cell_th1 Mouse T helper cell Th1 t-cell_th1 T-helper cell 1 ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Motomura Y., Kitamura H., Hijikata A., Matsunaga Y., Matsumoto K., Inoue H., Atarashi K., Hori S., Watarai H., Zhu J., Taniguchi M., Kubo M. IBD - Inflammatory bowel disease No results have been entered from assays using antibodies to Histone-H3, due to lack of antibody specificity. R4 TH1 cells:- TH1 cells given four rounds (R4) of simulation with mAb to TCR-beta and mAb to CD28 and then restimulated with mAb to TCR-beta. raysolfc@rcai.riken.jp Nature immunology 2011 Only protein-protein interactions imex curation imex curation motomura-2011-2 mouse-t-cell_th2 mouse helper T-lymphocyte Th2 Mouse t-cell_th2 T-helper cell 2 ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Motomura Y., Kitamura H., Hijikata A., Matsunaga Y., Matsumoto K., Inoue H., Atarashi K., Hori S., Watarai H., Zhu J., Taniguchi M., Kubo M. IBD - Inflammatory bowel disease No results have been entered from assays using antibodies to Histone-H3, due to lack of antibody specificity. raysolfc@rcai.riken.jp Nature immunology 2011 Only protein-protein interactions imex curation imex curation motomura-2011-3 in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Motomura Y., Kitamura H., Hijikata A., Matsunaga Y., Matsumoto K., Inoue H., Atarashi K., Hori S., Watarai H., Zhu J., Taniguchi M., Kubo M. IBD - Inflammatory bowel disease No results have been entered from assays using antibodies to Histone-H3, due to lack of antibody specificity. raysolfc@rcai.riken.jp Nature immunology 2011 Only protein-protein interactions imex curation imex curation il13_mouse_gene Interleukin-13 Il13 Il-13 gene gene mouse Mus musculus Mouse nfil3_mouse Nuclear factor interleukin-3-regulated protein Nfil3 E4bp4 E4 promoter-binding protein 4 Embryo implantation-related NFIL3/E4BP4-like transcription factor protein protein mouse Mus musculus Mouse MQLRKMQTIKKEPAPLDPTSSSDKMLLLNSALAEVAEDLASGEDLLLNEGSMGKNKSSACRRKREFIPDEKKDAMYWEKRRKNNEAAKRSREKRRLNDLVLENKLIALGEENATLKAELLSLKLKFGLISSTAYAQEIQKLSNSTAVYFQDYQTSKAAVSSFVDEHEPAMVAGSCISVIKHSPQSSLSDVSEVSSVEHTQESPAQGGCRSPENKFPVIKQEPVELESFAREAREERGTYSTSIYQSYMGSSFSTYSHSPPLLQVHGSTSNSPRTSEADEGVVGKSSDGEDEQQVPKGPIHSPVELQRVHATVVKVPEVNPSALPHKLRIKAKAMQVKVEALDSEFEGMQKLSSPADAIAKRHFDLEKHGTSGMAHSSLPPFSVQVTNIQDWSLKSEHWHHKELSSKTQSSFKTGVVEVKDGGYKVSEAENLYLKQGIANLSAEVVSLKRFIATQPISASDSR il10_mouse_gene Interleukin-10 gene gene gene mouse Mus musculus Mouse il13_promoter_probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid mouse Mus musculus Mouse CCATCTCCCGTTACATAAGGCCGCGCCTCT nfil3-il13-1 1882208 N/A 1882211 unspecified role unspecified role prey prey promoter_region_HS1_site sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 1882212 unspecified role unspecified role bait bait association association false false false 7B There was binding of E4BP4 to the HS1 site in R4 TH1 cells but not in conventional TH1 cells. O08750 increases the expression at protein level of ENSMUSG00000020383 O08750 increases the expression at RNA level of ENSMUSG00000020383 nfil3-il10_mouse_gene-1 1882209 N/A 1882213 unspecified role unspecified role prey prey regions_including_3-prime_non-coding_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 1882212 unspecified role unspecified role bait bait association association false false false 7D il13_promoter_probe-nfil3-1 1882210 N/A 1882212 unspecified role unspecified role prey prey mouse-t-cell_th2 mouse helper T-lymphocyte Th2 Mouse t-cell_th2 T-helper cell 2 N/A 1882214 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false 7C