IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ xu-2009-7 in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift tag visualisation tag visualisation Xu J., Yang Y., Qiu G., Lal G., Wu Z., Levy DE., Ochando JC., Bromberg JS., Ding Y. IBD - Inflammatory bowel disease CD4+CD25− T cells were stimulated with anti-CD3 and anti-CD28 mAbs, with IL-6 plus TGFbeta. yaozhong.ding@mssm.edu Journal of immunology (Baltimore, Md. : 1950) 2009 Only protein-protein interactions imex curation imex curation xu-2009-8 mouse-t-cell_cd4+ Mouse CD4 positive T-cell t-cell_cd4+ t cell cd4+ ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Xu J., Yang Y., Qiu G., Lal G., Wu Z., Levy DE., Ochando JC., Bromberg JS., Ding Y. IBD - Inflammatory bowel disease CD4+CD25− T cells stimulated with anti-CD3/28, with or without IL-6 and TGFbeta. yaozhong.ding@mssm.edu Journal of immunology (Baltimore, Md. : 1950) 2009 Only protein-protein interactions imex curation imex curation maf_mouse Transcription factor Maf Maf Maf2 Proto-oncogene c-Maf V-maf musculoaponeurotic fibrosarcoma oncogene homolog protein protein mouse Mus musculus Mouse MASELAMNNSDLPTSPLAMEYVNDFDLMKFEVKKEPVETDRIISQCGRLIAGGSLSSTPMSTPCSSVPPSPSFSAPSPGSGSEQKAHLEDYYWMTGYPQQLNPEALGFSPEDAVEALISNSHQLQGGFDGYARGAQQLAAAAGAGAGASLGGSGEEMGPAAAVVSAVIAAAAAQSGAAPHYHHHHHHAAGHHHHPTAGAPGAAGGASASASGAGGAGGGGPASAGGGGGGGGGGGTAGAGGALHPHHAAGGLHFDDRFSDEQLVTMSVRELNRQLRGVSKEEVIRLKQKRRTLKNRGYAQSCRFKRVQQRHVLESEKNQLLQQVDHLKQEISRLVRERDAYKEKYEKLVSNGFRENGSSSDNPSSPEFFM il10_promoter_mare_probe ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse CTAAGGTGACTTCCGAGTCAGCAAGAAATATCG il10_mouse_gene Interleukin-10 gene gene gene mouse Mus musculus Mouse il10_promoter_mare_probe-maf-1 1882349 N/A 1882351 unspecified role unspecified role prey prey cell lysate cell lysate mouse-t-cell_cd4+ Mouse CD4 positive T-cell t-cell_cd4+ t cell cd4+ N/A 1882352 unspecified role unspecified role bait bait purified purified region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false 6B maf-il10_mouse_gene-1 1882350 N/A 1882351 unspecified role unspecified role bait bait N/A 1882353 unspecified role unspecified role prey prey promoter_mare_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false 6C TGF-beta P08505 (IL6) P08505 increases the binding of P54843 to ENSMUSG00000016529 P52633 is not required for the binding of P54843 to ENSMUSG00000016529 P08505 increases the expression at RNA level of ENSMUSG00000016529 P54843 increases the expression at RNA level of ENSMUSG00000016529 P54843 increases the expression at protein level of ENSMUSG00000016529 P08505 decreases the P54843 induced expression at protein level of ENSMUSG00000016529 P08505 decreases the P54843 induced expression at RNA level of ENSMUSG00000016529