IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ jain-2007-2 HNF-1alpha plays an important role in IL-6-induced expression of the human angiotensinogen gene. in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Jain S., Li Y., Patil S., Kumar A. IBD - Inflammatory bowel disease sudhir_jain@nymc.edu Am. J. Physiol., Cell Physiol. (0363-6143) 2007 Only protein-protein interactions imex curation jain-2007-1 HNF-1alpha plays an important role in IL-6-induced expression of the human angiotensinogen gene. human-hep_3b Homo sapiens hepatocellular carcinoma (HCC) cells (p53-null). hep_3b human hepatocellular carcinoma (HCC) cells (p53-null). ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Jain S., Li Y., Patil S., Kumar A. IBD - Inflammatory bowel disease sudhir_jain@nymc.edu Am. J. Physiol., Cell Physiol. (0363-6143) 2007 Only protein-protein interactions imex curation stat3_human Signal transducer and activator of transcription 3 Acute-phase response factor STAT3 APRF protein protein human Homo sapiens Human MAQWNQLQQLDTRYLEQLHQLYSDSFPMELRQFLAPWIESQDWAYAASKESHATLVFHNLLGEIDQQYSRFLQESNVLYQHNLRRIKQFLQSRYLEKPMEIARIVARCLWEESRLLQTAATAAQQGGQANHPTAAVVTEKQQMLEQHLQDVRKRVQDLEQKMKVVENLQDDFDFNYKTLKSQGDMQDLNGNNQSVTRQKMQQLEQMLTALDQMRRSIVSELAGLLSAMEYVQKTLTDEELADWKRRQQIACIGGPPNICLDRLENWITSLAESQLQTRQQIKKLEELQQKVSYKGDPIVQHRPMLEERIVELFRNLMKSAFVVERQPCMPMHPDRPLVIKTGVQFTTKVRLLVKFPELNYQLKIKVCIDKDSGDVAALRGSRKFNILGTNTKVMNMEESNNGSLSAEFKHLTLREQRCGNGGRANCDASLIVTEELHLITFETEVYHQGLKIDLETHSLPVVVISNICQMPNAWASILWYNMLTNNPKNVNFFTKPPIGTWDQVAEVLSWQFSSTTKRGLSIEQLTTLAEKLLGPGVNYSGCQITWAKFCKENMAGKGFSFWVWLDNIIDLVKKYILALWNEGYIMGFISKERERAILSTKPPGTFLLRFSESSKEGGVTFTWVEKDISGKTQIQSVEPYTKQQLNNMSFAEIIMGYKIMDATNILVSPLVYLYPDIPKEEAFGKYCRPESQEHPEADPGSAAPYLKTKFICVTPTTCSNTIDLPMSPRTLDSLMQFGNNGEGAEPSAGGQFESLTFDMELTSECATSPM 6C00632211C8012D angt_human_apre-3_dna-probe Human ANGT gene promoter acute phase response element 3 DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human ACTAAGACTTCCTGGAAGAGGTCCCA hnf1a_human Hepatocyte nuclear factor 1-alpha Liver-specific transcription factor LF-B1 HNF1A TCF1 Transcription factor 1 protein protein human Homo sapiens Human MVSKLSQLQTELLAALLESGLSKEALIQALGEPGPYLLAGEGPLDKGESCGGGRGELAELPNGLGETRGSEDETDDDGEDFTPPILKELENLSPEEAAHQKAVVETLLQEDPWRVAKMVKSYLQQHNIPQREVVDTTGLNQSHLSQHLNKGTPMKTQKRAALYTWYVRKQREVAQQFTHAGQGGLIEEPTGDELPTKKGRRNRFKWGPASQQILFQAYERQKNPSKEERETLVEECNRAECIQRGVSPSQAQGLGSNLVTEVRVYNWFANRRKEEAFRHKLAMDTYSGPPPGPGPGPALPAHSSPGLPPPALSPSKVHGVRYGQPATSETAEVPSSSGGPLVTVSTPLHQVSPTGLEPSHSLLSTEAKLVSAAGGPLPPVSTLTALHSLEQTSPGLNQQPQNLIMASLPGVMTIGPGEPASLGPTFTNTGASTLVIGLASTQAQSVPVINSMGSSLTTLQPVQFSQPLHPSYQQPLMPPVQSHVTQSPFMATMAQLQSPHALYSHKPEVAQYTHTGLLPQTMLITDTTNLSALASLTPTKQVFTSDTEASSESGLHTPASQATTLHVPSQDPAGIQHLQPAHRLSASPTVSSSSLVLYQSSDSSNGQSHLLPSNHSVIETFISTQMASSSQ angt_human_apre-2_dna-probe Human ANGT gene promoter acute phase response element 2 DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human TGCAAACTTCGGTAAATGTGTAACTCGA hnf1a_consensus-site_dna-probe HNF1-alpha consensus binding site oligonucleotide DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) CCAGGTTAATGATTAACCCA angt_human_gene Angiotensinogen (AGT) human gene gene gene human Homo sapiens Human angt-stat3-1 1774092 n/a 1774094 unspecified role unspecified role prey prey human-hep_3b Homo sapiens hepatocellular carcinoma (HCC) cells (p53-null). hep_3b human hepatocellular carcinoma (HCC) cells (p53-null). n/a 1774095 unspecified role unspecified role bait bait 5-prime 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig. 7a interleukin-6 (IL-6) angt-hnf1a-1 1774092 n/a 1774096 unspecified role unspecified role prey prey human-hep_3b Homo sapiens hepatocellular carcinoma (HCC) cells (p53-null). hep_3b human hepatocellular carcinoma (HCC) cells (p53-null). n/a 1774097 unspecified role unspecified role bait bait 5-prime 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig. 3 hnf1a-hnf1a-1 1774092 n/a 1774098 unspecified role unspecified role bait bait 5-prime 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1774096 unspecified role unspecified role prey prey human-hep_3b Homo sapiens hepatocellular carcinoma (HCC) cells (p53-null). hep_3b human hepatocellular carcinoma (HCC) cells (p53-null). physical association physical association false false false Fig. 3 hnf1a-angt-1 1774093 n/a 1774099 unspecified role unspecified role prey prey promoter region apre-2 binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1774096 unspecified role unspecified role bait bait association association false false false Fig. 4 interleukin-6 (IL-6) P20823 increases expression at RNA level of ENSG00000135744 P20823 increases expression at protein level of ENSG00000135744 stat3-angt-1 1774093 n/a 1774094 unspecified role unspecified role bait bait n/a 1774099 unspecified role unspecified role prey prey promoter region apre-3 binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false promoter region apre-1/3 binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false Fig. 8 interleukin-6 (IL-6) P40763 increases expression at RNA level of ENSG00000135744 P40763 increases expression at protein level of ENSG00000135744 Hep3B cells were transfected with an AGT gene promoter construct containing either the APRE-3 region or both the APRE-1 and -3 regions fused to a luciferase gene. Co-precipitated DNA was amplified with an AGT-specific forward primer and a luciferase-specific reverse primer, allowing detection of only transfected co-precipitated DNA.