IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ juang-2005-1 Systemic lupus erythematosus serum IgG increases CREM binding to the IL-2 promoter and suppresses IL-2 production through CaMKIV. in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Juang Y.T., Wang Y., Solomou E.E., Li Y., Mawrin C., Tenbrock K., Kyttaris V.C., Tsokos G.C. IBD - Inflammatory bowel disease The human CaMKIV and rat CaMKII expression constructs are described in PMID:8702940 and PMID:8253736, respectively. The human IL2 promoter constructs are described in PMID:11238674 and PMID:1737937. IL2 promoter wild type and mutant probes are described in PMID:11238674 and PMID:11313407. gtsokos@usuhs.mil J. Clin. Invest. (0021-9738) 2005 Only protein-protein interactions imex curation il2_human_crem-site_dna-probe Human IL2 gene promoter CREM-binding site DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human CATCCATTCAGTCAGTCTTTGGGGGT crem_human cAMP-responsive element modulator CREM Inducible cAMP early repressor protein protein human Homo sapiens Human MTMETVESQHDGSITASLTESKSAHVQTQTGQNSIPALAQVSVAGSGTRRGSPAVTLVQLPSGQTIHVQGVIQTPQPWVIQSSEIHTVQVAAIAETDESAESEGVIDSHKRREILSRRPSYRKILNELSSDVPGVPKIEEERSEEEGTPPSIATMAVPTSIYQTSTGQYIAIAQGGTIQISNPGSDGVQGLQALTMTNSGAPPPGATIVQYAAQSADGTQQFFVPGSQVVVQDEETELAPSHMAAATGDMPTYQIRAPTAALPQGVVMAASPGSLHSPQQLAEEATRKRELRLMKNREAAKECRRRKKEYVKCLESRVAVLEVQNKKLIEELETLKDICSPKTDY creb1_human Cyclic AMP-responsive element-binding protein 1 CREB1 protein protein human Homo sapiens Human MTMESGAENQQSGDAAVTEAENQQMTVQAQPQIATLAQVSMPAAHATSSAPTVTLVQLPNGQTVQVHGVIQAAQPSVIQSPQVQTVQISTIAESEDSQESVDSVTDSQKRREILSRRPSYRKILNDLSSDAPGVPRIEEEKSEEETSAPAITTVTVPTPIYQTSSGQYIAITQGGAIQLANNGTDGVQGLQTLTMTNAAATQPGTTILQYAQTTDGQQILVPSNQVVVQAASGDVQTYQIRTAPTSTIAPGVVMASSPALPTQPAEEAARKREVRLMKNREAARECRRKKKEYVKCLENRVAVLENQNKTLIEELKALKDLYCHKSD il2-crem 1767956 n/a 1767957 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1767958 unspecified role unspecified role prey prey human-jurkat Homo sapiens jurkat Human T cell leukemia physical association physical association false false false Fig. 1b, 1c il2-crem-1 1767956 n/a 1767958 unspecified role unspecified role prey prey human-t-cell Homo sapiens t-cell Peripheral blood T-lymphocytes n/a 1767957 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig. 2b T cells were taken from an SLE (Systemic lupus erythematosus) patient. Q16566 increases binding of Q03060 to ENSG00000109471 in SLE T cells Q16566 indirectly decreases expression at RNA level of ENSG00000109471 in SLE T cells il2-crem-2 1767956 n/a 1767958 competitor competitor competitor prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1767958 unspecified role unspecified role prey prey human-jurkat Homo sapiens jurkat Human T cell leukemia n/a 1767957 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) association association false false false Fig. 1c il2-creb1 1767956 n/a 1767959 unspecified role unspecified role prey prey human-t-cell Homo sapiens t-cell Peripheral blood T-lymphocytes n/a 1767957 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig. 2b T cells were taken from an SLE (Systemic lupus erythematosus) patient.