IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ jahan-2005-3 Cytokine regulation of human sterol 12alpha-hydroxylase (CYP8B1) gene. in vitro In vitro protein kinase assay protein kinase assay autoradiography autoradiography Jahan A., Chiang J.Y. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis The authors also show in vitro phosphorylation of HNF4-alpha and serine alanine methionine serine (SAMS) peptide by AMPK; however, the exact identity of the different AMPK subunits could not be established, hence these interactions are not captured here. Information about active Jnk1 and ATF2 construct were obtained from the supplier's website (Upstate Cell Signaling Solutions/Millipore). jchiang@neoucom.edu Am. J. Physiol. Gastrointest. Liver Physiol. (0193-1857) 2005 Only protein-protein interactions imex curation IBD - Inflammatory bowel disease jahan-2005-1 Cytokine regulation of human sterol 12alpha-hydroxylase (CYP8B1) gene. in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Jahan A., Chiang J.Y. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis jchiang@neoucom.edu Am. J. Physiol. Gastrointest. Liver Physiol. (0193-1857) 2005 Only protein-protein interactions imex curation IBD - Inflammatory bowel disease jahan-2005-2 Cytokine regulation of human sterol 12alpha-hydroxylase (CYP8B1) gene. human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Jahan A., Chiang J.Y. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis jchiang@neoucom.edu Am. J. Physiol. Gastrointest. Liver Physiol. (0193-1857) 2005 Only protein-protein interactions imex curation IBD - Inflammatory bowel disease hnf4a_human Hepatocyte nuclear factor 4-alpha Transcription factor HNF-4 Nuclear receptor subfamily 2 group A member 1 Transcription factor 14 HNF4A HNF4 NR2A1 TCF14 protein protein human Homo sapiens Human MRLSKTLVDMDMADYSAALDPAYTTLEFENVQVLTMGNDTSPSEGTNLNAPNSLGVSALCAICGDRATGKHYGASSCDGCKGFFRRSVRKNHMYSCRFSRQCVVDKDKRNQCRYCRLKKCFRAGMKKEAVQNERDRISTRRSSYEDSSLPSINALLQAEVLSRQITSPVSGINGDIRAKKIASIADVCESMKEQLLVLVEWAKYIPAFCELPLDDQVALLRAHAGEHLLLGATKRSMVFKDVLLLGNDYIVPRHCPELAEMSRVSIRILDELVLPFQELQIDDNEYAYLKAIIFFDPDAKGLSDPGKIKRLRSQVQVSLEDYINDRQYDSRGRFGELLLLLPTLQSITWQMIEQIQFIKLFGMAKIDNLLQEMLLGGSPSDAPHAHHPLHPHLMQEHMGTNVIVANTMPTHLSNGQMCEWPRPRGQAATPETPQPSPPGGSGSEPYKLLPGAVATIVKPLSAIPQPTITKQEVI mk08_human Mitogen-activated protein kinase 8 MAPK8 JNK1 PRKM8 Stress-activated protein kinase JNK1 c-Jun N-terminal kinase 1 JNK-46 SAPK1 Stress-activated protein kinase 1c SAPK1C protein protein human Homo sapiens Human MSRSKRDNNFYSVEIGDSTFTVLKRYQNLKPIGSGAQGIVCAAYDAILERNVAIKKLSRPFQNQTHAKRAYRELVLMKCVNHKNIIGLLNVFTPQKSLEEFQDVYIVMELMDANLCQVIQMELDHERMSYLLYQMLCGIKHLHSAGIIHRDLKPSNIVVKSDCTLKILDFGLARTAGTSFMMTPYVVTRYYRAPEVILGMGYKENVDLWSVGCIMGEMVCHKILFPGRDYIDQWNKVIEQLGTPCPEFMKKLQPTVRTYVENRPKYAGYSFEKLFPDVLFPADSEHNKLKASQARDLLSKMLVIDASKRISVDEALQHPYINVWYDPSEAEAPPPKIPDKQLDEREHTIEEWKELIYKEVMDLEERTKNGVIRGQPSPLGAAVINGSQHPSSSSSVNDVSSMSTDPTLASDTDSSLEAAAGPLGCCR atf2_human Cyclic AMP-dependent transcription factor ATF-2 ATF2 CREB2 CREBP1 Activating transcription factor 2 cAMP response element-binding protein CRE-BP1 HB16 Cyclic AMP-responsive element-binding protein 2 protein protein human Homo sapiens Human MKFKLHVNSARQYKDLWNMSDDKPFLCTAPGCGQRFTNEDHLAVHKHKHEMTLKFGPARNDSVIVADQTPTPTRFLKNCEEVGLFNELASPFENEFKKASEDDIKKMPLDLSPLATPIIRSKIEEPSVVETTHQDSPLPHPESTTSDEKEVPLAQTAQPTSAIVRPASLQVPNVLLTSSDSSVIIQQAVPSPTSSTVITQAPSSNRPIVPVPGPFPLLLHLPNGQTMPVAIPASITSSNVHVPAAVPLVRPVTMVPSVPGIPGPSSPQPVQSEAKMRLKAALTQQHPPVTNGDTVKGHGSGLVRTQSEESRPQSLQQPATSTTETPASPAHTTPQTQSTSGRRRRAANEDPDEKRRKFLERNRAAASRCRQKRKVWVQSLEKKAEDLSSLNGQLQSEVTLLRNEVAQLKQLLLAHKDCPVTAMQKKSGYHTADKDDSSEDISVPSSPHTEAIQHSSVSTSNGVSSTSKAEAVATSVLTQMADQSTEPALSQIVMAPSSQSQPSGS cp8b1_human_hnf4a-site_dna-probe Human CP8B1 gene promoter HNF4a binding site DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human TTGCGGCCACAGGGCAAGGTCCAGGTGCTC cp8b1_human_gene 7-alpha-hydroxycholest-4-en-3-one 12-alpha-hydroxylase (CYP8B1) human gene gene gene human Homo sapiens Human hnf4a-mapk8 1771426 n/a 1771429 enzyme target enzyme target substrate substrate neutral component neutral component n-terminus gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecobb Escherichia coli (strain B / BL21) n/a 1771430 enzyme enzyme neutral component neutral component n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false spofr-sf_21 Spodoptera frugiperda insect cells sf_21 Insect cells derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae. full name: IPLB-SF-21-AE cells are susceptible to Baculovirus infection. phosphorylation phosphorylation reaction phosphorylation false false false Fig. 7 P45983 is required for phosphorylation of P41235 P45983 decreases expression at protein level of P41235 P41235 phosphorylated residue atf2-mapk8-1 1771426 n/a 1771431 enzyme target enzyme target substrate substrate neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false ecolx Escherichia coli n/a 1771430 enzyme enzyme neutral component neutral component n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false spofr-sf_21 Spodoptera frugiperda insect cells sf_21 Insect cells derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae. full name: IPLB-SF-21-AE cells are susceptible to Baculovirus infection. phosphorylation phosphorylation reaction phosphorylation false false false Fig. 7 P45983 is required for phosphorylation of P15336 P15336 phosphorylated residue cp8b1-hnf4a 1771427 n/a 1771432 unspecified role unspecified role bait bait dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) n/a 1771429 unspecified role unspecified role prey prey human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). physical association physical association false false false Fig. 5a IL1-beta hnf4a-cp8b1 1771428 n/a 1771433 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n/a 1771429 unspecified role unspecified role bait bait association association false false false Fig. 5b human Interleukin-1 beta (IL-1 beta) (P01584) chenodeoxycholic acid (CDCA) (CHEBI:16755) P01584 decreases binding of P41235 to ENSG00000180432 CHEBI:16755 decreases binding of P41235 to ENSG00000180432 P01584 indirectly decreases expression at RNA level of ENSG00000180432 CHEBI:16755 indirectly decreases expression at RNA level of ENSG00000180432 P41235 increases expression at RNA level of ENSG00000180432 P01584 indirectly decreases expression at RNA level of P41235 P01584 indirectly decreases expression at protein level of P41235 CHEBI:16755 indirectly decreases expression at RNA level of P41235 P45983 decreases expression at RNA level of ENSG00000180432 P05412 decreases expression at RNA level of ENSG00000180432