IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ lapalombella-2012-2 Tetraspanin CD37 Directly Mediates Transduction of Survival and Apoptotic Signals. human-697 Homo sapiens 697 Dexamethasone-resistant human Pre-B leukemia 697 cell line anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Lapalombella R., Yeh Y.Y., Wang L., Ramanunni A., Rafiq S., Jha S., Staubli J., Lucas D.M., Mani R., Herman S.E., Johnson A.J., Lozanski A., Andritsos L., Jones J., Flynn J.M., Lannutti B., Thompson P., Algate P., Stromatt S., Jarjoura D., Mo X., Wang D., Chen C.S., Lozanski G., Heerema N.A., Tridandapani S., Freitas M.A., Muthusamy N., Byrd J.C. Apoptosis - Interactions involving proteins with a function related to apoptosis SHP1 Activity assays not annotated as SHP1 was derived from a crude cell lysate IP. EMSA experiments -Figs 6E/F have not been annotated as the protein binding the probe has not been identified. GST Pulldown - Figure S2C - results cannot be included as the origin of GST-SHP1 is not given. IPs involving "p85" have not been entered as the antibody involved targets more than one molecule. The interactions shown here were only seen in the presence of SMIP-016(TM)+alphaFc (anti-human IgG) . SMIP-016 targets CD37 and is a a tumoricidal agent that induces tyrosine phosphorylation of multiple proteins. A SMIPs is a "Small Modular ImmunoPharmaceutical" - a bivalent engineered antibody fragment comprised of a binding variable domain linked to an immunoglobulin constant domain. john.byrd@osumc.edu, raj.muthusamy@osumc.edu Cancer Cell (1535-6108) 2012 Only protein-protein interactions imex curation Cancer - Interactions investigated in the context of cancer lapalombella-2012-3 Tetraspanin CD37 Directly Mediates Transduction of Survival and Apoptotic Signals. human-697 Homo sapiens 697 Dexamethasone-resistant human Pre-B leukemia 697 cell line anti bait coip anti bait coimmunoprecipitation anti bait coip anti tag western anti tag western blot anti tag western Lapalombella R., Yeh Y.Y., Wang L., Ramanunni A., Rafiq S., Jha S., Staubli J., Lucas D.M., Mani R., Herman S.E., Johnson A.J., Lozanski A., Andritsos L., Jones J., Flynn J.M., Lannutti B., Thompson P., Algate P., Stromatt S., Jarjoura D., Mo X., Wang D., Chen C.S., Lozanski G., Heerema N.A., Tridandapani S., Freitas M.A., Muthusamy N., Byrd J.C. Apoptosis - Interactions involving proteins with a function related to apoptosis SHP1 Activity assays not annotated as SHP1 was derived from a crude cell lysate IP. EMSA experiments -Figs 6E/F have not been annotated as the protein binding the probe has not been identified. GST Pulldown - Figure S2C - results cannot be included as the origin of GST-SHP1 is not given. IPs involving "p85" have not been entered as the antibody involved targets more than one molecule. The interactions shown here were only seen in the presence of SMIP-016(TM)+alphaFc (anti-human IgG) . SMIP-016 targets CD37 and is a a tumoricidal agent that induces tyrosine phosphorylation of multiple proteins. A SMIPs is a "Small Modular ImmunoPharmaceutical" - a bivalent engineered antibody fragment comprised of a binding variable domain linked to an immunoglobulin constant domain. john.byrd@osumc.edu, raj.muthusamy@osumc.edu Cancer Cell (1535-6108) 2012 Only protein-protein interactions imex curation Cancer - Interactions investigated in the context of cancer lapalombella-2012-1 Tetraspanin CD37 Directly Mediates Transduction of Survival and Apoptotic Signals. human-pbl-bcll Homo sapiens pbl-bcll: PBLs from human B cell Chronic Lymphocytic Leukaemia patients peripheral_blood_lymphocyte-bcll pbl-bcll: PBLs from B cell Chronic Lymphocytic Leukaemia patients B cell population was >95% CD19+ and >90% CD5+. anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Lapalombella R., Yeh Y.Y., Wang L., Ramanunni A., Rafiq S., Jha S., Staubli J., Lucas D.M., Mani R., Herman S.E., Johnson A.J., Lozanski A., Andritsos L., Jones J., Flynn J.M., Lannutti B., Thompson P., Algate P., Stromatt S., Jarjoura D., Mo X., Wang D., Chen C.S., Lozanski G., Heerema N.A., Tridandapani S., Freitas M.A., Muthusamy N., Byrd J.C. Apoptosis - Interactions involving proteins with a function related to apoptosis SHP1 Activity assays not annotated as SHP1 was derived from a crude cell lysate IP. EMSA experiments -Figs 6E/F have not been annotated as the protein binding the probe has not been identified. GST Pulldown - Figure S2C - results cannot be included as the origin of GST-SHP1 is not given. IPs involving "p85" have not been entered as the antibody involved targets more than one molecule. The interactions shown here were only seen in the presence of SMIP-016(TM)+alphaFc (anti-human IgG) . SMIP-016 targets CD37 and is a a tumoricidal agent that induces tyrosine phosphorylation of multiple proteins. A SMIPs is a "Small Modular ImmunoPharmaceutical" - a bivalent engineered antibody fragment comprised of a binding variable domain linked to an immunoglobulin constant domain. john.byrd@osumc.edu, raj.muthusamy@osumc.edu Cancer Cell (1535-6108) 2012 Only protein-protein interactions imex curation Cancer - Interactions investigated in the context of cancer lapalombella-2012-4 Tetraspanin CD37 Directly Mediates Transduction of Survival and Apoptotic Signals. in vitro In vitro pull down pull down western blot western blot Immuno blot Immuno blot Lapalombella R., Yeh Y.Y., Wang L., Ramanunni A., Rafiq S., Jha S., Staubli J., Lucas D.M., Mani R., Herman S.E., Johnson A.J., Lozanski A., Andritsos L., Jones J., Flynn J.M., Lannutti B., Thompson P., Algate P., Stromatt S., Jarjoura D., Mo X., Wang D., Chen C.S., Lozanski G., Heerema N.A., Tridandapani S., Freitas M.A., Muthusamy N., Byrd J.C. Apoptosis - Interactions involving proteins with a function related to apoptosis SHP1 Activity assays not annotated as SHP1 was derived from a crude cell lysate IP. EMSA experiments -Figs 6E/F have not been annotated as the protein binding the probe has not been identified. GST Pulldown - Figure S2C - results cannot be included as the origin of GST-SHP1 is not given. IPs involving "p85" have not been entered as the antibody involved targets more than one molecule. The interactions shown here were only seen in the presence of SMIP-016(TM)+alphaFc (anti-human IgG) . SMIP-016 targets CD37 and is a a tumoricidal agent that induces tyrosine phosphorylation of multiple proteins. A SMIPs is a "Small Modular ImmunoPharmaceutical" - a bivalent engineered antibody fragment comprised of a binding variable domain linked to an immunoglobulin constant domain. john.byrd@osumc.edu, raj.muthusamy@osumc.edu Cancer Cell (1535-6108) 2012 Only protein-protein interactions imex curation Cancer - Interactions investigated in the context of cancer lapalombella-2012-5 Tetraspanin CD37 Directly Mediates Transduction of Survival and Apoptotic Signals. human-pbl-bcll Homo sapiens pbl-bcll: PBLs from human B cell Chronic Lymphocytic Leukaemia patients peripheral_blood_lymphocyte-bcll pbl-bcll: PBLs from B cell Chronic Lymphocytic Leukaemia patients B cell population was >95% CD19+ and >90% CD5+. ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Lapalombella R., Yeh Y.Y., Wang L., Ramanunni A., Rafiq S., Jha S., Staubli J., Lucas D.M., Mani R., Herman S.E., Johnson A.J., Lozanski A., Andritsos L., Jones J., Flynn J.M., Lannutti B., Thompson P., Algate P., Stromatt S., Jarjoura D., Mo X., Wang D., Chen C.S., Lozanski G., Heerema N.A., Tridandapani S., Freitas M.A., Muthusamy N., Byrd J.C. Apoptosis - Interactions involving proteins with a function related to apoptosis SHP1 Activity assays not annotated as SHP1 was derived from a crude cell lysate IP. EMSA experiments -Figs 6E/F have not been annotated as the protein binding the probe has not been identified. GST Pulldown - Figure S2C - results cannot be included as the origin of GST-SHP1 is not given. IPs involving "p85" have not been entered as the antibody involved targets more than one molecule. The interactions shown here were only seen in the presence of SMIP-016(TM)+alphaFc (anti-human IgG) . SMIP-016 targets CD37 and is a a tumoricidal agent that induces tyrosine phosphorylation of multiple proteins. A SMIPs is a "Small Modular ImmunoPharmaceutical" - a bivalent engineered antibody fragment comprised of a binding variable domain linked to an immunoglobulin constant domain. john.byrd@osumc.edu, raj.muthusamy@osumc.edu Cancer Cell (1535-6108) 2012 Only protein-protein interactions imex curation Cancer - Interactions investigated in the context of cancer cd37_human Leukocyte antigen CD37 CD37 TSPAN26 Tetraspanin-26 protein protein human Homo sapiens Human MSAQESCLSLIKYFLFVFNLFFFVLGSLIFCFGIWILIDKTSFVSFVGLAFVPLQIWSKVLAISGIFTMGIALLGCVGALKELRCLLGLYFGMLLLLFATQITLGILISTQRAQLERSLRDVVEKTIQKYGTNPEETAAEESWDYVQFQLRCCGWHYPQDWFQVLILRGNGSEAHRVPCSCYNLSATNDSTILDKVILPQLSRLGHLARSRHSADICAVPAESHIYREGCAQGLQKWLHNNLISIVGICLGVGLLELGFMTLSIFLCRNLDHVYNRLARYR lyn_human Tyrosine-protein kinase Lyn JTK8 Lck/Yes-related novel protein tyrosine kinase V-yes-1 Yamaguchi sarcoma viral related oncogene homolog p53Lyn p56Lyn LYN protein protein human Homo sapiens Human MGCIKSKGKDSLSDDGVDLKTQPVRNTERTIYVRDPTSNKQQRPVPESQLLPGQRFQTKDPEEQGDIVVALYPYDGIHPDDLSFKKGEKMKVLEEHGEWWKAKSLLTKKEGFIPSNYVAKLNTLETEEWFFKDITRKDAERQLLAPGNSAGAFLIRESETLKGSFSLSVRDFDPVHGDVIKHYKIRSLDNGGYYISPRITFPCISDMIKHYQKQADGLCRRLEKACISPKPQKPWDKDAWEIPRESIKLVKRLGAGQFGEVWMGYYNNSTKVAVKTLKPGTMSVQAFLEEANLMKTLQHDKLVRLYAVVTREEPIYIITEYMAKGSLLDFLKSDEGGKVLLPKLIDFSAQIAEGMAYIERKNYIHRDLRAANVLVSESLMCKIADFGLARVIEDNEYTAREGAKFPIKWTAPEAINFGCFTIKSDVWSFGILLYEIVTYGKIPYPGRTNADVMTALSQGYRMPRVENCPDELYDIMKMCWKEKAEERPTFDYLQSVLDDFYTATEGQYQQQP ksyk_human Tyrosine-protein kinase SYK SYK Spleen tyrosine kinase p72-Syk protein protein human Homo sapiens Human MASSGMADSANHLPFFFGNITREEAEDYLVQGGMSDGLYLLRQSRNYLGGFALSVAHGRKAHHYTIERELNGTYAIAGGRTHASPADLCHYHSQESDGLVCLLKKPFNRPQGVQPKTGPFEDLKENLIREYVKQTWNLQGQALEQAIISQKPQLEKLIATTAHEKMPWFHGKISREESEQIVLIGSKTNGKFLIRARDNNGSYALCLLHEGKVLHYRIDKDKTGKLSIPEGKKFDTLWQLVEHYSYKADGLLRVLTVPCQKIGTQGNVNFGGRPQLPGSHPATWSAGGIISRIKSYSFPKPGHRKSSPAQGNRQESTVSFNPYEPELAPWAADKGPQREALPMDTEVYESPYADPEEIRPKEVYLDRKLLTLEDKELGSGNFGTVKKGYYQMKKVVKTVAVKILKNEANDPALKDELLAEANVMQQLDNPYIVRMIGICEAESWMLVMEMAELGPLNKYLQQNRHVKDKNIIELVHQVSMGMKYLEESNFVHRDLAARNVLLVTQHYAKISDFGLSKALRADENYYKAQTHGKWPVKWYAPECINYYKFSSKSDVWSFGVLMWEAFSYGQKPYRGMKGSEVTAMLEKGERMGCPAGCPREMYDLMNLCWTYDVENRPGFAAVELRLRNYYYDVVN ptn6_human Tyrosine-protein phosphatase non-receptor type 6 PTPN6 HCP Protein-tyrosine phosphatase 1C Hematopoietic cell protein-tyrosine phosphatase SH-PTP1 Protein-tyrosine phosphatase SHP-1 PTP1C protein protein human Homo sapiens Human MVRWFHRDLSGLDAETLLKGRGVHGSFLARPSRKNQGDFSLSVRVGDQVTHIRIQNSGDFYDLYGGEKFATLTELVEYYTQQQGVLQDRDGTIIHLKYPLNCSDPTSERWYHGHMSGGQAETLLQAKGEPWTFLVRESLSQPGDFVLSVLSDQPKAGPGSPLRVTHIKVMCEGGRYTVGGLETFDSLTDLVEHFKKTGIEEASGAFVYLRQPYYATRVNAADIENRVLELNKKQESEDTAKAGFWEEFESLQKQEVKNLHQRLEGQRPENKGKNRYKNILPFDHSRVILQGRDSNIPGSDYINANYIKNQLLGPDENAKTYIASQGCLEATVNDFWQMAWQENSRVIVMTTREVEKGRNKCVPYWPEVGMQRAYGPYSVTNCGEHDTTEYKLRTLQVSPLDNGDLIREIWHYQYLSWPDHGVPSEPGGVLSFLDQINQRQESLPHAGPIIVHCSAGIGRTGTIIVIDMLMENISTKGLDCDIDIQKTIQMVRAQRSGMVQTEAQYKFIYVAIAQFIETTKKKLEVLQSQKGQESEYGNITYPPAMKNAHAKASRTSSKHKEDVYENLHTKNKREEKVKKQRSADKEKSKGSLKRK pk3cd_human Phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit delta isoform PIK3CD Phosphatidylinositol 4,5-bisphosphate 3-kinase 110 kDa catalytic subunit delta protein protein human Homo sapiens Human MPPGVDCPMEFWTKEENQSVVVDFLLPTGVYLNFPVSRNANLSTIKQLLWHRAQYEPLFHMLSGPEAYVFTCINQTAEQQELEDEQRRLCDVQPFLPVLRLVAREGDRVKKLINSQISLLIGKGLHEFDSLCDPEVNDFRAKMCQFCEEAAARRQQLGWEAWLQYSFPLQLEPSAQTWGPGTLRLPNRALLVNVKFEGSEESFTFQVSTKDVPLALMACALRKKATVFRQPLVEQPEDYTLQVNGRHEYLYGSYPLCQFQYICSCLHSGLTPHLTMVHSSSILAMRDEQSNPAPQVQKPRAKPPPIPAKKPSSVSLWSLEQPFRIELIQGSKVNADERMKLVVQAGLFHGNEMLCKTVSSSEVSVCSEPVWKQRLEFDINICDLPRMARLCFALYAVIEKAKKARSTKKKSKKADCPIAWANLMLFDYKDQLKTGERCLYMWPSVPDEKGELLNPTGTVRSNPNTDSAAALLICLPEVAPHPVYYPALEKILELGRHSECVHVTEEEQLQLREILERRGSGELYEHEKDLVWKLRHEVQEHFPEALARLLLVTKWNKHEDVAQMLYLLCSWPELPVLSALELLDFSFPDCHVGSFAIKSLRKLTDDELFQYLLQLVQVLKYESYLDCELTKFLLDRALANRKIGHFLFWHLRSEMHVPSVALRFGLILEAYCRGSTHHMKVLMKQGEALSKLKALNDFVKLSSQKTPKPQTKELMHLCMRQEAYLEALSHLQSPLDPSTLLAEVCVEQCTFMDSKMKPLWIMYSNEEAGSGGSVGIIFKNGDDLRQDMLTLQMIQLMDVLWKQEGLDLRMTPYGCLPTGDRTGLIEVVLRSDTIANIQLNKSNMAATAAFNKDALLNWLKSKNPGEALDRAIEEFTLSCAGYCVATYVLGIGDRHSDNIMIRESGQLFHIDFGHFLGNFKTKFGINRERVPFILTYDFVHVIQQGKTNNSEKFERFRGYCERAYTILRRHGLLFLHLFALMRAAGLPELSCSKDIQYLKDSLALGKTEEEALKHFRVKFNEALRESWKTKVNWLAHNVSKDNRQ A38B5D1A1081A3D0 pk3cg_human Phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit gamma isoform PIK3CG p120-PI3K Phosphoinositide-3-kinase catalytic gamma polypeptide Serine/threonine protein kinase PIK3CG Phosphatidylinositol 4,5-bisphosphate 3-kinase 110 kDa catalytic subunit gamma protein protein human Homo sapiens Human MELENYKQPVVLREDNCRRRRRMKPRSAAASLSSMELIPIEFVLPTSQRKCKSPETALLHVAGHGNVEQMKAQVWLRALETSVAADFYHRLGPHHFLLLYQKKGQWYEIYDKYQVVQTLDCLRYWKATHRSPGQIHLVQRHPPSEESQAFQRQLTALIGYDVTDVSNVHDDELEFTRRGLVTPRMAEVASRDPKLYAMHPWVTSKPLPEYLWKKIANNCIFIVIHRSTTSQTIKVSPDDTPGAILQSFFTKMAKKKSLMDIPESQSEQDFVLRVCGRDEYLVGETPIKNFQWVRHCLKNGEEIHVVLDTPPDPALDEVRKEEWPLVDDCTGVTGYHEQLTIHGKDHESVFTVSLWDCDRKFRVKIRGIDIPVLPRNTDLTVFVEANIQHGQQVLCQRRTSPKPFTEEVLWNVWLEFSIKIKDLPKGALLNLQIYCGKAPALSSKASAESPSSESKGKVQLLYYVNLLLIDHRFLLRRGEYVLHMWQISGKGEDQGSFNADKLTSATNPDKENSMSISILLDNYCHPIALPKHQPTPDPEGDRVRAEMPNQLRKQLEAIIATDPLNPLTAEDKELLWHFRYESLKHPKAYPKLFSSVKWGQQEIVAKTYQLLARREVWDQSALDVGLTMQLLDCNFSDENVRAIAVQKLESLEDDDVLHYLLQLVQAVKFEPYHDSALARFLLKRGLRNKRIGHFLFWFLRSEIAQSRHYQQRFAVILEAYLRGCGTAMLHDFTQQVQVIEMLQKVTLDIKSLSAEKYDVSSQVISQLKQKLENLQNSQLPESFRVPYDPGLKAGALAIEKCKVMASKKKPLWLEFKCADPTALSNETIGIIFKHGDDLRQDMLILQILRIMESIWETESLDLCLLPYGCISTGDKIGMIEIVKDATTIAKIQQSTVGNTGAFKDEVLNHWLKEKSPTEEKFQAAVERFVYSCAGYCVATFVLGIGDRHNDNIMITETGNLFHIDFGHILGNYKSFLGINKERVPFVLTPDFLFVMGTSGKKTSPHFQKFQDICVKAYLALRHHTNLLIILFSMMLMTGMPQLTSKEDIEYIRDALTVGKNEEDAKKYFLDQIEVCRDKGWTVQFNWFLHLVLGIKQGEKHSA syk_human Lysine--tRNA ligase KARS1 KARS KIAA0070 Lysyl-tRNA synthetase protein protein human Homo sapiens Human MAAVQAAEVKVDGSEPKLSKNELKRRLKAEKKVAEKEAKQKELSEKQLSQATAAATNHTTDNGVGPEEESVDPNQYYKIRSQAIHQLKVNGEDPYPHKFHVDISLTDFIQKYSHLQPGDHLTDITLKVAGRIHAKRASGGKLIFYDLRGEGVKLQVMANSRNYKSEEEFIHINNKLRRGDIIGVQGNPGKTKKGELSIIPYEITLLSPCLHMLPHLHFGLKDKETRYRQRYLDLILNDFVRQKFIIRSKIITYIRSFLDELGFLEIETPMMNIIPGGAVAKPFITYHNELDMNLYMRIAPELYHKMLVVGGIDRVYEIGRQFRNEGIDLTHNPEFTTCEFYMAYADYHDLMEITEKMVSGMVKHITGSYKVTYHPDGPEGQAYDVDFTPPFRRINMVEELEKALGMKLPETNLFETEETRKILDDICVAKAVECPPPRTTARLLDKLVGEFLEVTCINPTFICDHPQIMSPLAKWHRSKEGLTERFELFVMKKEICNAYTELNDPMRQRQLFEEQAKAKAAGDDEAMFIDENFCTALEYGLPPTAGWGMGIDRVAMFLTDSNNIKEVLLFPAMKPEDKKENVATTDTLESTTVGTSV foxo3_human Forkhead box protein O3 FOXO3 FKHRL1 FOXO3A Forkhead in rhabdomyosarcoma-like 1 AF6q21 protein protein protein human Homo sapiens Human MAEAPASPAPLSPLEVELDPEFEPQSRPRSCTWPLQRPELQASPAKPSGETAADSMIPEEEDDEDDEDGGGRAGSAMAIGGGGGSGTLGSGLLLEDSARVLAPGGQDPGSGPATAAGGLSGGTQALLQPQQPLPPPQPGAAGGSGQPRKCSSRRNAWGNLSYADLITRAIESSPDKRLTLSQIYEWMVRCVPYFKDKGDSNSSAGWKNSIRHNLSLHSRFMRVQNEGTGKSSWWIINPDGGKSGKAPRRRAVSMDNSNKYTKSRGRAAKKKAALQTAPESADDSPSQLSKWPGSPTSRSSDELDAWTDFRSRTNSNASTVSGRLSPIMASTELDEVQDDDAPLSPMLYSSSASLSPSVSKPCTVELPRLTDMAGTMNLNDGLTENLMDDLLDNITLPPSQPSPTGGLMQRSSSFPYTTKGSGLGSPTSSFNSTVFGPSSLNSLRQSPMQTIQENKPATFSSMSHYGNQTLQDLLTSDSLSHSDVMMTQSDPLMSQASTAVSAQNSRRNVMLRNDPMMSFAAQPNQGSLVNQNLLHHQHQTQGALGGSRALSNSVSNMGLSESSSLGSAKHQQQSPVSQSMQTLSDSLSGSSLYSTSANLPVMGHEKFPSDLDLDMFNGSLECDMESIIRSELMDADGLDFNFDSLISTQNVVGLNVGNFTGAKQASSQSWVPG E5B4E830665A9982 bim_human_promoter_probe human BIM promoter probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human CAGAGTTACTCCGGTAAACACGCCAGGGAC bim_human_gene Human Bim gene gene gene human Homo sapiens Human lyn-cd37-1 1294571 n/a 1294576 unspecified role unspecified role prey prey n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false n/a 1294577 unspecified role unspecified role bait bait physical association physical association false false false Fig 3E CD37 associates with LYN, SHP1, and SYK upon ligation with SMIP-016. SMIP-016(TM)+alphaFc (anti-human IgG). syk-cd37 1294571 n/a 1294578 unspecified role unspecified role bait bait n/a 1294576 unspecified role unspecified role prey prey n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false physical association physical association false false false Fig 3E CD37 associates with LYN, SHP1, and SYK upon ligation with SMIP-016. SMIP-016(TM)+alphaFc (anti-human IgG). shp1-cd37 1294571 n/a 1294576 unspecified role unspecified role prey prey n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false n/a 1294579 unspecified role unspecified role bait bait physical association physical association false false false Fig 3E CD37 associates with LYN, SHP1, and SYK upon ligation with SMIP-016. SMIP-016(TM)+alphaFc (anti-human IgG). cd37-lyn 1294571 n/a 1294577 unspecified role unspecified role prey prey n/a 1294576 unspecified role unspecified role bait bait n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false c-t(-)_deletion construct sufficient to bind sufficient binding region sufficient to bind range range range range false P11049:p.Tyr13Phe mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false n/a 1294578 unspecified role unspecified role prey prey association association false false false Fig 3F CD37 associates with LYN, SHP1, and SYK upon ligation with SMIP-016. SMIP-016(TM)+alphaFc (anti-human IgG). lyn-ptpn6 1294571 n/a 1294579 unspecified role unspecified role prey prey n/a 1294577 unspecified role unspecified role bait bait physical association physical association false false false Fig S2B Lack of the (CD37) C-t region did not prevent co-association of LYN and SHP1 (Figure S2B). However the replacement of Tyr13 with Phe notably reduced SMIP-016-induced CD37 phosphorylation and prevented association of SHP1 and LYN. SMIP-016(TM)+alphaFc (anti-human IgG). syk-cd37-1 1294572 n/a 1294576 unspecified role unspecified role prey prey n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false c-t(-)_deletion construct sufficient to bind sufficient binding region sufficient to bind range range range range false n/a 1294578 unspecified role unspecified role bait bait physical association physical association false false false Fig 4G SMIP-016(TM)+alphaFc (anti-human IgG). lyn-cd37 1294572 n/a 1294576 unspecified role unspecified role prey prey n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false c-t(-)_deletion construct sufficient to bind sufficient binding region sufficient to bind range range range range false P11049:p.Tyr13Phe mutation disrupting mutation disrupting interaction mutation disrupting certain certain sequence position certain certain certain sequence position certain false n/a 1294577 unspecified role unspecified role bait bait physical association physical association false false false Fig 4G, 4I SMIP-016(TM)+alphaFc (anti-human IgG). shp1-cd37-2 1294572 n/a 1294579 unspecified role unspecified role bait bait n/a 1294576 unspecified role unspecified role prey prey P11049:p.Tyr13Phe mutation disrupting mutation disrupting interaction mutation disrupting certain certain sequence position certain certain certain sequence position certain false n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false c-t(-)_deletion construct sufficient to bind sufficient binding region sufficient to bind range range range range false physical association physical association false false false Fig 4G,4I, 4J SMIP-016(TM)+alphaFc (anti-human IgG). Herbimycin lyn-cd37-2 1294572 n/a 1294576 unspecified role unspecified role prey prey region required to bind necessary binding region required to bind range range range range false n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false n/a 1294580 unspecified role unspecified role bait bait physical association physical association false false false Fig 4K SMIP-016(TM)+alphaFc (anti-human IgG). pik3cd-cd37 1294572 n/a 1294581 unspecified role unspecified role bait bait n/a 1294576 unspecified role unspecified role prey prey n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range false c-t(-)_deletion construct sufficient to bind sufficient binding region sufficient to bind range range range range false physical association physical association false false false Fig 4N SMIP-016(TM)+alphaFc (anti-human IgG). ptpn6-cd37 1294573 n/a 1294576 unspecified role unspecified role prey prey n/a 1294579 unspecified role unspecified role bait bait physical association physical association false false false Fig 1F, S1H. CD37 was tyrosine phosphorylated and associated with both SHP1 and LYN. This reaction was only seen in the presence of SMIP-016(TM)+alphaFc (anti-human IgG) -SMIP-016 targets CD37 and is a a tumoricidal agent that induces tyrosine phosphorylation of multiple proteins. A SMIPs is a "Small Modular ImmunoPharmaceutical" - a bivalent engineered antibody fragment comprised of a binding variable domain linked to an immunoglobulin constant domain. lyn-cd37 1294573 n/a 1294576 unspecified role unspecified role prey prey n/a 1294577 unspecified role unspecified role bait bait physical association physical association false false false Fig 1F, S1H. CD37 was tyrosine phosphorylated and associated with both SHP1 and LYN. This reaction was only seen in the presence of SMIP-016(TM)+alphaFc (anti-human IgG) -SMIP-016 targets CD37 and is a a tumoricidal agent that induces tyrosine phosphorylation of multiple proteins. A SMIPs is a "Small Modular ImmunoPharmaceutical" - a bivalent engineered antibody fragment comprised of a binding variable domain linked to an immunoglobulin constant domain. cd37-kars-1 1294573 n/a 1294579 unspecified role unspecified role prey prey n/a 1294576 unspecified role unspecified role bait bait n/a 1294577 unspecified role unspecified role prey prey n/a 1294582 unspecified role unspecified role prey prey association association false false false Fig S1H. CD37 was tyrosine phosphorylated and associated with both SHP1 and LYN. This reaction was only seen in the presence of SMIP-016(TM)+alphaFc (anti-human IgG) -SMIP-016 targets CD37 and is a a tumoricidal agent that induces tyrosine phosphorylation of multiple proteins. A SMIPs is a "Small Modular ImmunoPharmaceutical" - a bivalent engineered antibody fragment comprised of a binding variable domain linked to an immunoglobulin constant domain. bim-foxo3 1294574 n/a 1294583 unspecified role unspecified role prey prey human-pbl-bcll Homo sapiens pbl-bcll: PBLs from human B cell Chronic Lymphocytic Leukaemia patients peripheral_blood_lymphocyte-bcll pbl-bcll: PBLs from B cell Chronic Lymphocytic Leukaemia patients B cell population was >95% CD19+ and >90% CD5+. n/a 1294584 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association false false false Fig 6G SMIP-016+αFc-treated Nuclear extracts from cells were used. foxo3-bim 1294575 n/a 1294583 unspecified role unspecified role bait bait n/a 1294585 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false Fig 6H SMIP-016+alpha-Fc-treated