IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ bernier-2006-3 Binding of manumycin A inhibits IkappaB kinase beta activity. human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). anti tag coip anti tag coimmunoprecipitation anti tag coip western blot western blot Immuno blot Immuno blot Bernier M., Kwon YK., Pandey SK., Zhu TN., Zhao RJ., Maciuk A., He HJ., Decabo R., Kole S. BioCreative - Critical Assessment of Information Extraction systems in Biology Bernierm@grc.nia.nih.gov J. Biol. Chem. (0021-9258) 2006 Only protein-protein interactions imex curation bernier-2006-2 Binding of manumycin A inhibits IkappaB kinase beta activity. in vitro In vitro protein kinase assay protein kinase assay predetermined predetermined participant predetermined Bernier M., Kwon YK., Pandey SK., Zhu TN., Zhao RJ., Maciuk A., He HJ., Decabo R., Kole S. BioCreative - Critical Assessment of Information Extraction systems in Biology Additional details on substrate taken from vendors website Serum-starved HepG2 cells were left untreated or treated with 10 �M manumycin for 30 min before the addition of 20 ng/ml TNF for 5 min. Extracts were immunoprecipitated with a polyclonal antibody directed against IKKbeta or IKKgamma, and solid phase kinase assays were performed. Reactions were separated by SDS-PAGE, transferred to PVDF membrane, and exposed to film to detect phosphorylated substrate. Bernierm@grc.nia.nih.gov J. Biol. Chem. (0021-9258) 2006 Only protein-protein interactions imex curation bernier-2006-1 Binding of manumycin A inhibits IkappaB kinase beta activity. in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa predetermined predetermined participant predetermined Bernier M., Kwon YK., Pandey SK., Zhu TN., Zhao RJ., Maciuk A., He HJ., Decabo R., Kole S. BioCreative - Critical Assessment of Information Extraction systems in Biology Bernierm@grc.nia.nih.gov J. Biol. Chem. (0021-9258) 2006 Only protein-protein interactions imex curation bernier-2006-4 Binding of manumycin A inhibits IkappaB kinase beta activity. human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Bernier M., Kwon YK., Pandey SK., Zhu TN., Zhao RJ., Maciuk A., He HJ., Decabo R., Kole S. BioCreative - Critical Assessment of Information Extraction systems in Biology Bernierm@grc.nia.nih.gov J. Biol. Chem. (0021-9258) 2006 Only protein-protein interactions imex curation ikkb_mouse Inhibitor of nuclear factor kappa-B kinase subunit beta I-kappa-B kinase 2 Nuclear factor NF-kappa-B inhibitor kinase beta Ikbkb Ikkb Serine/threonine protein kinase IKBKB protein protein mouse Mus musculus Mouse MSWSPSLPTQTCGAWEMKERLGTGGFGNVIRWHNQATGEQIAIKQCRQELSPKNRNRWCLEIQIMRRLNHPNVVAARDVPEGMQNLAPNDLPLLAMEYCQGGDLRRYLNQFENCCGLREGAVLTLLSDIASALRYLHENRIIHRDLKPENIVLQQGEKRLIHKIIDLGYAKELDQGSLCTSFVGTLQYLAPELLEQQKYTVTVDYWSFGTLAFECITGFRPFLPNWQPVQWHSKVRQKSEVDIVVSEDLNGAVKFSSSLPFPNNLNSVLAERLEKWLQLMLMWHPRQRGTDPQYGPNGCFRALDDILNLKLVHVLNMVTGTVHTYPVTEDESLQSLKTRIQENTGILETDQELLQKAGLVLLPDKPATQCISDSKTNEGLTLDMDLVFLLDNSKINYETQITPRPPPESVSCILQEPKRNLSFFQLRKVWGQVWHSIQTLKEDCNRLQQGQRAAMMSLLRNNSCLSKMKNAMASTAQQLKAKLDFFKTSIQIDLEKYKEQTEFGITSDKLLLAWREMEQAVEQCGRENDVKHLVERMMALQTDIVDLQRSPMGRKQGGTLDDLEEQARELYRKLREKPRDQRTEGDSQEMVRLLLQAIQSFEKKVRVIYTQLSKTVVCKQKALELLPKVEEVVSLMNEDERTVVRLQEKRQKELWNLLKIACSKVRGPVSGSPDSMNVSRLSHPGQLMSQPSSACDSLPESDKKSEELVAEAHALCSRLESALQDTVKEQDRSFTTLDWSWLQMEDEERCSLEQACD ikkb_human Inhibitor of nuclear factor kappa-B kinase subunit beta IKBKB IKKB I-kappa-B kinase 2 Nuclear factor NF-kappa-B inhibitor kinase beta Serine/threonine protein kinase IKBKB protein protein human Homo sapiens Human MSWSPSLTTQTCGAWEMKERLGTGGFGNVIRWHNQETGEQIAIKQCRQELSPRNRERWCLEIQIMRRLTHPNVVAARDVPEGMQNLAPNDLPLLAMEYCQGGDLRKYLNQFENCCGLREGAILTLLSDIASALRYLHENRIIHRDLKPENIVLQQGEQRLIHKIIDLGYAKELDQGSLCTSFVGTLQYLAPELLEQQKYTVTVDYWSFGTLAFECITGFRPFLPNWQPVQWHSKVRQKSEVDIVVSEDLNGTVKFSSSLPYPNNLNSVLAERLEKWLQLMLMWHPRQRGTDPTYGPNGCFKALDDILNLKLVHILNMVTGTIHTYPVTEDESLQSLKARIQQDTGIPEEDQELLQEAGLALIPDKPATQCISDGKLNEGHTLDMDLVFLFDNSKITYETQISPRPQPESVSCILQEPKRNLAFFQLRKVWGQVWHSIQTLKEDCNRLQQGQRAAMMNLLRNNSCLSKMKNSMASMSQQLKAKLDFFKTSIQIDLEKYSEQTEFGITSDKLLLAWREMEQAVELCGRENEVKLLVERMMALQTDIVDLQRSPMGRKQGGTLDDLEEQARELYRRLREKPRDQRTEGDSQEMVRLLLQAIQSFEKKVRVIYTQLSKTVVCKQKALELLPKVEEVVSLMNEDEKTVVRLQEKRQKELWNLLKIACSKVRGPVSGSPDSMNASRLSQPGQLMSQPSTASNSLPEPAKKSEELVAEAHNLCTLLENAIQDTVREQDQSFTALDWSWLQTEEEEHSCLEQAS ikka_human Inhibitor of nuclear factor kappa-B kinase subunit alpha CHUK IKKA TCF16 I-kappa-B kinase 1 Conserved helix-loop-helix ubiquitous kinase Nuclear factor NF-kappa-B inhibitor kinase alpha Transcription factor 16 protein protein human Homo sapiens Human MERPPGLRPGAGGPWEMRERLGTGGFGNVCLYQHRELDLKIAIKSCRLELSTKNRERWCHEIQIMKKLNHANVVKACDVPEELNILIHDVPLLAMEYCSGGDLRKLLNKPENCCGLKESQILSLLSDIGSGIRYLHENKIIHRDLKPENIVLQDVGGKIIHKIIDLGYAKDVDQGSLCTSFVGTLQYLAPELFENKPYTATVDYWSFGTMVFECIAGYRPFLHHLQPFTWHEKIKKKDPKCIFACEEMSGEVRFSSHLPQPNSLCSLVVEPMENWLQLMLNWDPQQRGGPVDLTLKQPRCFVLMDHILNLKIVHILNMTSAKIISFLLPPDESLHSLQSRIERETGINTGSQELLSETGISLDPRKPASQCVLDGVRGCDSYMVYLFDKSKTVYEGPFASRSLSDCVNYIVQDSKIQLPIIQLRKVWAEAVHYVSGLKEDYSRLFQGQRAAMLSLLRYNANLTKMKNTLISASQQLKAKLEFFHKSIQLDLERYSEQMTYGISSEKMLKAWKEMEEKAIHYAEVGVIGYLEDQIMSLHAEIMELQKSPYGRRQGDLMESLEQRAIDLYKQLKHRPSDHSYSDSTEMVKIIVHTVQSQDRVLKELFGHLSKLLGCKQKIIDLLPKVEVALSNIKEADNTVMFMQGKRQKEIWHLLKIACTQSSARSLVGSSLEGAVTPQTSAWLPPTSAEHDHSLSCVVTPQDGETSAQMIEENLNCLGHLSTIIHEANEEQGNSMMNLDWSWLTE nemo_human NF-kappa-B essential modulator IKBKG FIP3 NEMO NF-kappa-B essential modifier Inhibitor of nuclear factor kappa-B kinase subunit gamma IkB kinase-associated protein 1 FIP-3 protein protein human Homo sapiens Human MNRHLWKSQLCEMVQPSGGPAADQDVLGEESPLGKPAMLHLPSEQGAPETLQRCLEENQELRDAIRQSNQILRERCEELLHFQASQREEKEFLMCKFQEARKLVERLGLEKLDLKRQKEQALREVEHLKRCQQQMAEDKASVKAQVTSLLGELQESQSRLEAATKECQALEGRARAASEQARQLESEREALQQQHSVQVDQLRMQGQSVEAALRMERQAASEEKRKLAQLQVAYHQLFQEYDNHIKSSVVGSERKRGMQLEDLKQQLQQAEEALVAKQEVIDKLKEEAEQHKIVMETVPVLKAQADIYKADFQAERQAREKLAEKKELLQEQLEQLQREYSKLKASCQESARIEDMRKRHVEVSQAPLPPAPAYLSSPLALPSQRRSPPEEPPDFCCPKCQYQAPDMDTLQIHVMECIE ikba_human NF-kappa-B inhibitor alpha NFKBIA IKBA MAD3 NFKBI I-kappa-B-alpha Major histocompatibility complex enhancer-binding protein MAD3 protein protein human Homo sapiens Human MFQAAERPQEWAMEGPRDGLKKERLLDDRHDSGLDSMKDEEYEQMVKELQEIRLEPQEVPRGSEPWKQQLTEDGDSFLHLAIIHEEKALTMEVIRQVKGDLAFLNFQNNLQQTPLHLAVITNQPEIAEALLGAGCDPELRDFRGNTPLHLACEQGCLASVGVLTQSCTTPHLHSILKATNYNGHTCLHLASIHGYLGIVELLVSLGADVNAQEPCNGRTALHLAVDLQNPDLVSLLLKCGADVNRVTYQGYSPYQLTWGRPSTRIQQQLGQLTLENLQMLPESEDEESYDTESEFTEFTEDELPYDDCVFGGQRLTL kabbab site double-stranded oligonucleotide encompassing a putative kappa-B site ds dna double stranded deoxyribonucleic acid ds DNA ds dna in vitro In vitro AATTCATGCAGTTGAGGGGACTTTCCCAGGCATGCA tf65 Chinese hamster TF65 protein protein crigr Cricetulus griseus (Chinese hamster) Cricetulus barabensis griseus Chinese hamster An amino acid sequence which is not represented in UniProt ikbkb-2 Homodimerisation of I-kappa kinase beta 504384 N/A 504388 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 504388 unspecified role unspecified role prey prey region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false physical association physical association false false false 5C & 5D Manumycin A - inhibited by cys mutations (C662A/C716A). Effects of Manumycin A overcome by addition of dithiothreitol. ikbkb-4 Homodimerisation of I-kappa kinase beta 504384 N/A 504389 unspecified role unspecified role prey prey region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 504389 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false physical association physical association false false false 6C Manumycin A ikbkb-5 Heterodimerisation of I-kappa kinase beta and I-kappa kinase alpha 504384 N/A 504389 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false N/A 504390 unspecified role unspecified role prey prey region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false physical association physical association false false false 6C Manumycin A ikbkb-nfkbia-4 Association of I-kappa kinase beta and I-kappa kinase gamma 504384 N/A 504391 unspecified role unspecified role prey prey N/A 504389 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false physical association physical association false false false 7A Manumycin A - inhibited by cys mutation (C179A) ikbkb-nfkbia-3 Phosphorylation of I-kappa B alpha by I-kappa kinase beta 504385 N/A 504391 unspecified role unspecified role ancillary ancillary human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). N/A 504392 enzyme target enzyme target substrate substrate unspecified role unspecified role n-terminal gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 504389 enzyme enzyme unspecified role unspecified role human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). phosphorylation phosphorylation reaction phosphorylation false false false 5A & 5B TNFalpha (20ng/ml for 5 minutes) Manumycin A - sensitivity effected by a series of cys mutations of IKBKB (C179A < WT C662A/C716A) Phosphorylation of NFKBIA Anti-IKKgamma also immunoprecipitated kinase activity - since this protein has no intrinsic kinase activity, it was assumed to be part of the active complex ikbkb-1 Autophosphorylation of I-kappa kinase beta 504385 n/a 504389 putative self putative self putative self putative self region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). Stoichiometry: 1.0 phosphorylation phosphorylation reaction phosphorylation false true false 5B TNFalpha (20ng/ml for 5 minutes) Manumycin A - sensitivity effected by a series of cys mutations (C179A < WT C662A/C716A) Autophosphorylation of NFKBIA ikbkb-3 Autophosphorylation of I-kappa kinase beta 504385 n/a 504388 putative self putative self putative self putative self Stoichiometry: 1.0 phosphorylation phosphorylation reaction phosphorylation false true false 5D Manumycin A - inhibited by cys mutations (C662A/C716A). Effects of Manumycin A overcome by addition of dithiothreitol. Autophosphorylation of NFKBIA kappab-tf65 504386 N/A 504393 unspecified role unspecified role neutral component neutral component g17_18t mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false N/A 504394 unspecified role unspecified role neutral component neutral component physical association physical association false false false 1D ikbkb-nfkbia-5 Association of I-kappa B alpha, I-kappa kinase beta and I-kappa kinase gamma 504387 N/A 504390 unspecified role unspecified role prey prey N/A 504391 unspecified role unspecified role bait bait N/A 504389 unspecified role unspecified role prey prey region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false association association false false false 7B TNFalpha (20ng/ml for 5 minutes) Manumycin A