IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ fan-2008-1 XPD helicase structures and activities: insights into the cancer and aging phenotypes from XPD mutations. in vitro In vitro atpase assay atpase assay predetermined predetermined participant predetermined Fan L., Fuss JO., Cheng QJ., Arvai AS., Hammel M., Roberts VA., Cooper PK., Tainer JA. Archaea - Interaction dataset based on Archaea proteins ATPase assay performed in the presence of single stranded DNA jat@scripps.edu Cell (0092-8674) 2008 fan-2008-2 XPD helicase structures and activities: insights into the cancer and aging phenotypes from XPD mutations. in vitro In vitro enzymatic study enzymatic study predetermined predetermined participant predetermined Fan L., Fuss JO., Cheng QJ., Arvai AS., Hammel M., Roberts VA., Cooper PK., Tainer JA. Archaea - Interaction dataset based on Archaea proteins ATPase assay performed in the presence of single stranded DNA jat@scripps.edu Cell (0092-8674) 2008 fan-2008-3 XPD helicase structures and activities: insights into the cancer and aging phenotypes from XPD mutations. in vitro In vitro x-ray diffraction x-ray crystallography X-ray X-ray x-ray diffraction predetermined predetermined participant predetermined Fan L., Fuss JO., Cheng QJ., Arvai AS., Hammel M., Roberts VA., Cooper PK., Tainer JA. Archaea - Interaction dataset based on Archaea proteins ATPase assay performed in the presence of single stranded DNA jat@scripps.edu Cell (0092-8674) 2008 atp ATP Adenosine 5'-triphosphate Adenosine triphosphate ADENOSINE-5'-TRIPHOSPHATE Adephos Adetol Adynol Atipi ATP Atriphos Cardenosine Fosfobion Glucobasin H4atp Myotriphos Triadenyl Triphosphaden adenosine 5'-(tetrahydrogen triphosphate) small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) xpd_sulac ATP-dependent DNA helicase Saci_0192 Saci_0192 protein protein sulac Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770) MLKLRDWQEKLKDKVIEGLRNNFLVALNAPTGSGKTLFSLLVSLEVKPKVLFVVRTHNEFYPIYRDLTKIREKRNITFSFLVGKPSSCLYAEKGAESEDIPCKYCELKGSIVEVKTDDSPLSLVKKLKKDGLQDKFCPYYSLLNSLYKADVIALTYPYFFIDRYREFIDIDLREYMIVIDEAHNLDKVNELEERSLSEITIQMAIKQSKSEESRRILSKLLNQLREVVLPDEKYIKVENVPKLSKEELEILADDYEDIRKDSLKQGKVNKIHIGSILRFFSLLSIGSFIPFSYSKRLVIKNPEISYYLNLLNDNELSIILMSGTLPPREYMEKVWGIKRNMLYLDVEREIQKRVSGSYECYIGVDVTSKYDMRSDNMWKRYADYLLKIYFQAKANVLVVFPSYEIMDRVMSRISLPKYVESEDSSVEDLYSAISANNKVLIGSVGKGKLAEGIELRNNDRSLISDVVIVGIPYPPPDDYLKILAQRVSLKMNRENEEFLFKIPALVTIKQAIGRAIRDVNDKCNVWLLDKRFESLYWKKNLKCLNANKMKL 25mer_dna 25mer DNA dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) CCTCGAGGGATCCGTCCTAGCAAGC 50mer_dna 50mer DNA dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) GCTCGAGTCTAGACTGCAGTTGAGAGCTTGCTAGGACGGATCCCTCGAGG tetra-mu3-sulfido-tetrairon tetra-mu(3)-sulfido-tetrairon (IRON/SULFUR CLUSTER) small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) xpd-atp-1 ATPase activity of XPD 743537 N/A 743540 enzyme target enzyme target substrate substrate neutral component neutral component N/A 743541 enzyme enzyme neutral component neutral component Q4JC68:p.Gly34Arg mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Arg514Trp mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Asp180Asn mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Gly447Asp mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Arg531Trp mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Cys102Ser mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Thr56Ala mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Tyr403Cys mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Cys88Ser mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Lys446Leu mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Cys523Arg mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Lys84His mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Lys438Pro mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Asp521Gly mutation increasing mutation increasing interaction mutation increasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) atpase reaction atpase reaction false false false ATP-hydrolysis rate = 0.55 mol ATP per second per mol Sulfolobus acidocaldarius XPD with single-stranded DNA. Fig. 4 Table 2 xpd-atp-2 Helicase activity of XPD 743538 N/A 743542 enzyme target enzyme target substrate substrate neutral component neutral component N/A 743543 enzyme target enzyme target substrate substrate neutral component neutral component N/A 743541 enzyme enzyme neutral component neutral component Q4JC68:p.Gly34Arg mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Arg514Trp mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Asp180Asn mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Gly447Asp mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Arg531Trp mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Cys102Ser mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Thr56Ala mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Tyr403Cys mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Cys88Ser mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Lys369Gln mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Lys446Leu mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Cys523Arg mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Lys84His mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false Q4JC68:p.Asp521Gly mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) dna elongation dna strand elongation DNA replication elongation dna elongation false false false Helicase assay rate = 2.22 base pairs per minute per molecule Sulfolobus acidocaldarius XPD. Fig. 4 Table 2, Supp. Fig. 6 By an oxidising agent - ferricyanide xpd-4fe-4s 743539 N/A 743544 unspecified role unspecified role neutral component neutral component N/A 743541 unspecified role unspecified role neutral component neutral component direct interaction direct interaction false false false Fig. 1, Table 1 2.0A working 22.2%, free 26.0%