IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ madureira-2006-1 The Forkhead box M1 protein regulates the transcription of the estrogen receptor alpha in breast cancer cells. in vitro In vitro pull down pull down western blot western blot Immuno blot Immuno blot Madureira PA., Varshochi R., Constantinidou D., Francis RE., Coombes RC., Yao KM., Lam EW. Apoptosis - Interactions involving proteins with a function related to apoptosis Oligonucleotides containing different Forkhead-responsive elements (FHREs)of the human Estrogen Receptor alpha (ERalpha) with 5' ends either free or conjugated to biotin. The oligonucleotides were incubated with nuclear extracts prepared from cycling MCF-7 cells. eric.lam@imperial.ac.uk J. Biol. Chem. (0021-9258) 2006 Only protein-protein interactions imex curation Cancer - Interactions investigated in the context of cancer madureira-2006-2 The Forkhead box M1 protein regulates the transcription of the estrogen receptor alpha in breast cancer cells. human-mcf7 Homo sapiens mammary carcinoma cells mcf7 mammary carcinoma cells ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Madureira PA., Varshochi R., Constantinidou D., Francis RE., Coombes RC., Yao KM., Lam EW. Apoptosis - Interactions involving proteins with a function related to apoptosis Protein-DNA complexes from cycling MCF-7 were analyzed. eric.lam@imperial.ac.uk J. Biol. Chem. (0021-9258) 2006 Only protein-protein interactions imex curation Cancer - Interactions investigated in the context of cancer Oligonucleotides containing different Forkhead-responsive elements (FHREs)of the human Estrogen Receptor alpha (ERalpha) with 5' ends either free or conjugated to biotin. The oligonucleotides were incubated with nuclear extracts prepared from cycling MCF-7 cells. madureira-2006-3 The Forkhead box M1 protein regulates the transcription of the estrogen receptor alpha in breast cancer cells. human-mcf7 Homo sapiens mammary carcinoma cells mcf7 mammary carcinoma cells anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Madureira PA., Varshochi R., Constantinidou D., Francis RE., Coombes RC., Yao KM., Lam EW. Apoptosis - Interactions involving proteins with a function related to apoptosis eric.lam@imperial.ac.uk J. Biol. Chem. (0021-9258) 2006 Only protein-protein interactions imex curation Cancer - Interactions investigated in the context of cancer Oligonucleotides containing different Forkhead-responsive elements (FHREs)of the human Estrogen Receptor alpha (ERalpha) with 5' ends either free or conjugated to biotin. The oligonucleotides were incubated with nuclear extracts prepared from cycling MCF-7 cells. s1s2_human_dna S1S2 oligonucleotide containing Forkhead response element based on human ERalpha promoter ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human CAATATTTATTTATATCCAGTATTTATTTTCAATAC foxm1_human Forkhead box protein M1 Hepatocyte nuclear factor 3 forkhead homolog 11 Winged-helix factor from INS-1 cells M-phase phosphoprotein 2 MPM-2 reactive phosphoprotein 2 Transcription factor Trident Forkhead-related protein FKHL16 WIN FOXM1 FKHL16 HFH11 MPP2 protein protein human Homo sapiens Human MKTSPRRPLILKRRRLPLPVQNAPSETSEEEPKRSPAQQESNQAEASKEVAESNSCKFPAGIKIINHPTMPNTQVVAIPNNANIHSIITALTAKGKESGSSGPNKFILISCGGAPTQPPGLRPQTQTSYDAKRTEVTLETLGPKPAARDVNLPRPPGALCEQKRETCADGEAAGCTINNSLSNIQWLRKMSSDGLGSRSIKQEMEEKENCHLEQRQVKVEEPSRPSASWQNSVSERPPYSYMAMIQFAINSTERKRMTLKDIYTWIEDHFPYFKHIAKPGWKNSIRHNLSLHDMFVRETSANGKVSFWTIHPSANRYLTLDQVFKPLDPGSPQLPEHLESQQKRPNPELRRNMTIKTELPLGARRKMKPLLPRVSSYLVPIQFPVNQSLVLQPSVKVPLPLAASLMSSELARHSKRVRIAPKVLLAEEGIAPLSSAGPGKEEKLLFGEGFSPLLPVQTIKEEEIQPGEEMPHLARPIKVESPPLEEWPSPAPSFKEESSHSWEDSSQSPTPRPKKSYSGLRSPTRCVSEMLVIQHRERRERSRSRRKQHLLPPCVDEPELLFSEGPSTSRWAAELPFPADSSDPASQLSYSQEVGGPFKTPIKETLPISSTPSKSVLPRTPESWRLTPPAKVGGLDFSPVQTSQGASDPLPDPLGLMDLSTTPLQSAPPLESPQRLLSSEPLDLISVPFGNSSPSDIDVPKPGSPEPQVSGLAANRSLTEGLVLDTMNDSLSKILLDISFPGLDEDPLGPDNINWSQFIPELQ s4_human_dna S4 oligonucleotide containing Forkhead response element based on human ERalpha promoter ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human ATTTTTCACATGTTTACAGAAAGCAGTCAACTGAGC s6s7_human_dna S6S7 oligonucleotide containing Forkhead response element based on human ERalpha promoter ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human GAGGAGGGGGAATCAAACAGAAAGAGAGACAAACAGAGATATATC s8_human_dna S8 oligonucleotide containing Forkhead response element based on human ERalpha promoter ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human ATCGAGTTGTGCCTGGAGTGATGTTTAAGCCAATGTCAGGGCAAGG foxo3_human Forkhead box protein O3 FOXO3 FKHRL1 FOXO3A Forkhead in rhabdomyosarcoma-like 1 AF6q21 protein protein protein human Homo sapiens Human MAEAPASPAPLSPLEVELDPEFEPQSRPRSCTWPLQRPELQASPAKPSGETAADSMIPEEEDDEDDEDGGGRAGSAMAIGGGGGSGTLGSGLLLEDSARVLAPGGQDPGSGPATAAGGLSGGTQALLQPQQPLPPPQPGAAGGSGQPRKCSSRRNAWGNLSYADLITRAIESSPDKRLTLSQIYEWMVRCVPYFKDKGDSNSSAGWKNSIRHNLSLHSRFMRVQNEGTGKSSWWIINPDGGKSGKAPRRRAVSMDNSNKYTKSRGRAAKKKAALQTAPESADDSPSQLSKWPGSPTSRSSDELDAWTDFRSRTNSNASTVSGRLSPIMASTELDEVQDDDAPLSPMLYSSSASLSPSVSKPCTVELPRLTDMAGTMNLNDGLTENLMDDLLDNITLPPSQPSPTGGLMQRSSSFPYTTKGSGLGSPTSSFNSTVFGPSSLNSLRQSPMQTIQENKPATFSSMSHYGNQTLQDLLTSDSLSHSDVMMTQSDPLMSQASTAVSAQNSRRNVMLRNDPMMSFAAQPNQGSLVNQNLLHHQHQTQGALGGSRALSNSVSNMGLSESSSLGSAKHQQQSPVSQSMQTLSDSLSGSSLYSTSANLPVMGHEKFPSDLDLDMFNGSLECDMESIIRSELMDADGLDFNFDSLISTQNVVGLNVGNFTGAKQASSQSWVPG E5B4E830665A9982 eralpha_human_gene Human estrogen receptor alpha gene gene human Homo sapiens Human s1s2_human-foxm1 FOXM1 binds S1S2 oligonucleotide containing Forkhead response element based on ERalpha promoter 729571 N/A 729574 unspecified role unspecified role bait bait N/A 729575 unspecified role unspecified role prey prey human-mcf7 Homo sapiens mammary carcinoma cells mcf7 mammary carcinoma cells physical association physical association false false false 5 A The oligonucleotide was biotinylated. A non-biotinylated FHRE-containing oligonucleotide competed off FOXM1 binding to S1S2 in a concentration-dependent manner. s4_human-foxm1 FOXM1 binds S4 oligonucleotide containing Forkhead response element based on ERalpha promoter 729571 N/A 729576 unspecified role unspecified role bait bait N/A 729575 unspecified role unspecified role prey prey human-mcf7 Homo sapiens mammary carcinoma cells mcf7 mammary carcinoma cells physical association physical association false false false 5 A The oligonucleotide was biotinylated. A non-biotinylated FHRE-containing oligonucleotide competed off FOXM1 binding to S4 in a concentration-dependent manner. s6s7_human-foxm1 FOXM1 binds an oligonucleotide containing Forkhead response element based on ERalpha promoter 729571 N/A 729575 unspecified role unspecified role prey prey human-mcf7 Homo sapiens mammary carcinoma cells mcf7 mammary carcinoma cells N/A 729577 unspecified role unspecified role bait bait physical association physical association false false false 5 A The oligonucleotide was biotinylated. A non-biotinylated FHRE-containing oligonucleotide competed off FOXM1 binding to S6S7 in a concentration-dependent manner. s8_human-foxm1 FOXM1 binds an oligonucleotide containing Forkhead response element based on ERalpha promoter 729571 N/A 729578 unspecified role unspecified role bait bait N/A 729575 unspecified role unspecified role prey prey human-mcf7 Homo sapiens mammary carcinoma cells mcf7 mammary carcinoma cells physical association physical association false false false 5 A The oligonucleotide was biotinylated. A non-biotinylated FHRE-containing oligonucleotide competed off FOXM1 binding to S8 in a concentration-dependent manner. s1s2_human-foxo3 FOXO3 binds S1S2 oligonucleotide containing Forkhead response element based on ERalpha promoter 729571 N/A 729579 unspecified role unspecified role prey prey human-mcf7 Homo sapiens mammary carcinoma cells mcf7 mammary carcinoma cells N/A 729574 unspecified role unspecified role bait bait physical association physical association false false false 5 A The oligonucleotide was biotinylated. A non-biotinylated FHRE-containing oligonucleotide competed off FOXO3 binding to S1S2 in a concentration-dependent manner. s4_human-foxo3 FOXO3 binds S4 oligonucleotide containing Forkhead response element based on ERalpha promoter 729571 N/A 729579 unspecified role unspecified role prey prey human-mcf7 Homo sapiens mammary carcinoma cells mcf7 mammary carcinoma cells N/A 729576 unspecified role unspecified role bait bait physical association physical association false false false 5 A The oligonucleotide was biotinylated. A non-biotinylated FHRE-containing oligonucleotide competed off FOXO3 binding to S4 in a concentration-dependent manner. s6s7_human-foxo3 FOXO31 binds an oligonucleotide containing Forkhead response element based on ERalpha promoter 729571 N/A 729577 unspecified role unspecified role bait bait N/A 729579 unspecified role unspecified role prey prey human-mcf7 Homo sapiens mammary carcinoma cells mcf7 mammary carcinoma cells physical association physical association false false false 5 A The oligonucleotide was biotinylated. A non-biotinylated FHRE-containing oligonucleotide competed off FOXO3 binding to S6S7 in a concentration-dependent manner. s8_human-foxo3 FOXO3 binds an oligonucleotide containing Forkhead response element based on ERalpha promoter 729571 N/A 729579 unspecified role unspecified role prey prey human-mcf7 Homo sapiens mammary carcinoma cells mcf7 mammary carcinoma cells N/A 729578 unspecified role unspecified role bait bait physical association physical association false false false 5 A The oligonucleotide was biotinylated. A non-biotinylated FHRE-containing oligonucleotide competed off FOXO3 binding to S8 in a concentration-dependent manner. foxo3-eralpha_hum FOXO3 binds to the ERalpha promoter region in a ChIP assay 729572 N/A 729579 unspecified role unspecified role bait bait N/A 729580 unspecified role unspecified role prey prey association association false false false 5 B FOXO3 bound the region of the ERalpha promoter containing the S1/S2, S4 and S6/S7 FHREs. foxm1-eralpha_hum-1 FOXM1 binds to the ERalpha promoter region in a ChIP assay 729572 N/A 729575 unspecified role unspecified role bait bait N/A 729580 unspecified role unspecified role prey prey association association false false false 5 B FOXM1 bound the region of the ERalpha promoter containing the S1/S2, S4 and S6/S7 FHREs. foxo3-foxm1 FOXO3 coimmunoprecipitates FOXM1 inMCF-7 lysates 729573 N/A 729579 unspecified role unspecified role bait bait N/A 729575 unspecified role unspecified role prey prey physical association physical association false false false 6 foxm1-foxo3 FOXO3 coimmunoprecipitates with FOXM1 inMCF-7 lysates 729573 N/A 729579 unspecified role unspecified role prey prey N/A 729575 unspecified role unspecified role bait bait physical association physical association false false false 6