IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Structure and dynamics of SARS-CoV-2 proofreading exoribonuclease ExoN. Structure and dynamics of SARS-CoV-2 proofreading exoribonuclease ExoN. bioRxiv : the preprint server for biology 2021 imex curation Moeller NH., Shi K., Demir Ö., Banerjee S., Yin L., Belica C., Durfee C., Amaro RE., Aihara H. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus aihar001@umn.edu Only protein-protein interactions imex curation ecoli Escherichia coli (strain K12) x-ray diffraction x-ray crystallography X-ray X-ray x-ray diffraction predetermined predetermined participant predetermined Moeller NH., Shi K., Demir Ö., Banerjee S., Yin L., Belica C., Durfee C., Amaro RE., Aihara H. Virus - Publications including interactions involving viral proteins aihar001@umn.edu Accepted 2021-AUG-23 AT 16:25 BST AT 16:25 BST by MGT bioRxiv : the preprint server for biology 2021 Only protein-protein interactions imex curation imex curation Mock publication and experiment for abstract interactions that are not interaction evidences. Mock publication and experiment for abstract interactions that are not interaction evidences. unspecified method Structure and dynamics of SARS-CoV-2 proofreading exoribonuclease ExoN. Structure and dynamics of SARS-CoV-2 proofreading exoribonuclease ExoN. bioRxiv : the preprint server for biology 2021 imex curation Moeller NH., Shi K., Demir Ö., Banerjee S., Yin L., Belica C., Durfee C., Amaro RE., Aihara H. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus aihar001@umn.edu Only protein-protein interactions imex curation in vitro In vitro ribonuclease assay ribonuclease assay tag visualisation tag visualisation Moeller NH., Shi K., Demir Ö., Banerjee S., Yin L., Belica C., Durfee C., Amaro RE., Aihara H. Virus - Publications including interactions involving viral proteins aihar001@umn.edu Accepted 2021-AUG-23 AT 16:25 BST AT 16:25 BST by MGT bioRxiv : the preprint server for biology 2021 Only protein-protein interactions imex curation imex curation p0c6x7-pro_0000037317 Non-structural protein 10 rep ORF1ab polyprotein 1a-1b protein protein sars-cov Human SARS coronavirus SARS-CoV Severe acute respiratory syndrome coronavirus AGNATEVPANSTVLSFCAFAVDPAKAYKDYLASGGQPITNCVKMLCTHTGTGQAITVTPEANMDQESFGGASCCLYCRCHIDHPNPKGFCDLKGKYVQIPTTCANDPVGFTLRNTVCTVCGMWKGYGCSCDQLREPLMQ 4231 4369 1F48DD3A6874826C ls2u rna ls2u rna rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) GUCAUUCUCCUAAGAAGCUU poly a rna poly A rna rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA p0dtd1-pro_0000449631 Proofreading exoribonuclease nsp14 rep ORF1ab polyprotein 1a-1b protein protein SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV AENVTGLFKDCSKVITGLHPTQAPTHLSVDTKFKTEGLCVDIPGIPKDMTYRRLISMMGFKMNYQVNGYPNMFITREEAIRHVRAWIGFDVEGCHATREAVGTNLPLQLGFSTGVNLVAVPTGYVDTPNNTDFSRVSAKPPPGDQFKHLIPLMYKGLPWNVVRIKIVQMLSDTLKNLSDRVVFVLWAHGFELTSMKYFVKIGPERTCCLCDRRATCFSTASDTYACWHHSIGFDYVYNPFMIDVQQWGFTGNLQSNHDLYCQVHGNAHVASCDAIMTRCLAVHECFVKRVDWTIEYPIIGDELKINAACRKVQHMVVKAALLADKFPVLHDIGNPKAIKCVPQADVEWKFYDAQPCSDKAYKIEELFYSYATHSDKFTDGVCLFWNCNVDRYPANSIVCRFDTRVLSNLNLPGCDGGSLYVNKHAFHTPAFDKSAFVNLKQLPFFYYSDSPCESHGKQVVSDIDYVPLKSATCITRCNLGGAVCRHHANEYRLYLDAYNMMISAGFSLWVYKQFDTYNLWNTFTRLQ 5926 6452 ls15_dna ss dna single stranded deoxyribonucleic acid ss DNA ss dna chemical synthesis Chemical synthesis (Chemical synthesis) CTATCCCCATGTGATTTTACTAGCTTCTTAGGAGAATGAC ls15a rna ls15a rna rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) CUAUCCCCAUGUGAUUUUACAAGCUUCUUAGGAGAAUGAC p0c6x7-pro_0000037320 Proofreading exoribonuclease nsp14 rep ORF1ab polyprotein 1a-1b protein protein sars-cov Human SARS coronavirus SARS-CoV Severe acute respiratory syndrome coronavirus AENVTGLFKDCSKIITGLHPTQAPTHLSVDIKFKTEGLCVDIPGIPKDMTYRRLISMMGFKMNYQVNGYPNMFITREEAIRHVRAWIGFDVEGCHATRDAVGTNLPLQLGFSTGVNLVAVPTGYVDTENNTEFTRVNAKPPPGDQFKHLIPLMYKGLPWNVVRIKIVQMLSDTLKGLSDRVVFVLWAHGFELTSMKYFVKIGPERTCCLCDKRATCFSTSSDTYACWNHSVGFDYVYNPFMIDVQQWGFTGNLQSNHDQHCQVHGNAHVASCDAIMTRCLAVHECFVKRVDWSVEYPIIGDELRVNSACRKVQHMVVKSALLADKFPVLHDIGNPKAIKCVPQAEVEWKFYDAQPCSDKAYKIEELFYSYATHHDKFTDGVCLFWNCNVDRYPANAIVCRFDTRVLSNLNLPGCDGGSLYVNKHAFHTPAFDKSAFTNLKQLPFFYYSDSPCESHGKQVVSDIDYVPLKSATCITRCNLGGAVCRHHANEYRQYLDAYNMMISAGFSLWIYKQFDTYNLWNTFTRLQ 5903 6429 D8E25737EF40967D poly u rna poly U rna rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) UUUUUUUUUUUUUUUUUUUU p0dtd1-pro_0000449628 Non-structural protein 10 rep ORF1ab polyprotein 1a-1b protein protein SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV AGNATEVPANSTVLSFCAFAVDAAKAYKDYLASGGQPITNCVKMLCTHTGTGQAITVTPEANMDQESFGGASCCLYCRCHIDHPNPKGFCDLKGKYVQIPTTCANDPVGFTLKNTVCTVCGMWKGYGCSCDQLREPMLQ 4254 4392 rep-rep-187 1 12 unspecified role unspecified role neutral component neutral component purified purified 7 unspecified role unspecified role neutral component neutral component purified purified ExoN domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain P0DTD1-PRO_0000449631:p.Glu191Gln mutation mutation certain certain sequence position certain certain certain sequence position certain E Q direct interaction direct interaction Table 2 rep-rep-188 3 20 enzyme enzyme neutral component neutral component purified purified ExoN domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 22 P0DTD1-PRO_0000449631:p.Glu191Gln mutation disrupting rate mutation disrupting interaction rate mutation disrupting rate certain certain sequence position certain certain certain sequence position certain E Q 22 P0DTD1-PRO_0000449631:p.Lys9Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain K A 22 P0DTD1-PRO_0000449631:p.Lys61Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain K A 22 P0DTD1-PRO_0000449631:p.Lys139Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain K A 22 ecoli Escherichia coli (strain K12) 5 enzyme target enzyme target substrate substrate neutral component neutral component 5'-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) rna cleavage rna cleavage 4a ls15a rna-ls2u rna-1 3 9 stimulator stimulator neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 32 enzyme enzyme neutral component neutral component purified purified ExoN domain sufficient to bind sufficient binding region sufficient to bind range range range range 34 ecoli Escherichia coli (strain K12) 5 enzyme target enzyme target substrate substrate neutral component neutral component 5'-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) rna cleavage rna cleavage SF1 ls15a rna-ls2u rna-2 3 20 enzyme enzyme neutral component neutral component purified purified ExoN domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 22 ecoli Escherichia coli (strain K12) 5 enzyme target enzyme target substrate substrate neutral component neutral component 5'-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 9 stimulator stimulator neutral component neutral component mutant-n.21A>U mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain A U chemical synthesis Chemical synthesis (Chemical synthesis) rna cleavage rna cleavage 1a, 1b More extensive degradation was observed when LS2U RNA was annealed to an unlabeled 40-nt template strand (LS15A_RNA) to generate a double-stranded (ds) RNA with a 20-nt 5'-overhang nsp10_nsp14_sars2_1-poly a rna-1 3 11 enzyme target enzyme target substrate substrate neutral component neutral component 5'-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 20 enzyme enzyme neutral component neutral component purified purified P0DTD1-PRO_0000449631:p.Glu191Gln mutation disrupting rate mutation disrupting interaction rate mutation disrupting rate certain certain sequence position certain certain certain sequence position certain E Q 22 ExoN domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 22 ecoli Escherichia coli (strain K12) 6 ancillary ancillary neutral component neutral component rna cleavage rna cleavage 1c A 20-nt poly-U RNA, which is less likely to adopt secondary structures did not serve as a substrate by itself but was degraded extensively when supplemented with a complementary 30-nt poly-A RNA nsp10_nsp14_cvhsa-poly a rna-1 3 11 enzyme target enzyme target substrate substrate neutral component neutral component 5'-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain 32 enzyme enzyme neutral component neutral component purified purified ExoN domain sufficient to bind sufficient binding region sufficient to bind range range range range 34 ecoli Escherichia coli (strain K12) 6 ancillary ancillary neutral component neutral component rna cleavage rna cleavage 1c A 20-nt poly-U RNA, which is less likely to adopt secondary structures did not serve as a substrate by itself but was degraded extensively when supplemented with a complementary 30-nt poly-A RNA ls2u rna-nsp10_nsp14_sars2_1-1 3 20 enzyme enzyme neutral component neutral component purified purified ExoN domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 22 ecoli Escherichia coli (strain K12) 5 enzyme target enzyme target substrate substrate neutral component neutral component 5'-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) rna cleavage rna cleavage 1a, 1b ls15a rna-ls2u rna-3 3 20 enzyme enzyme neutral component neutral component purified purified ExoN domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 22 P0DTD1-PRO_0000449631:p.Glu191Gln mutation disrupting rate mutation disrupting interaction rate mutation disrupting rate certain certain sequence position certain certain certain sequence position certain E Q 22 P0DTD1-PRO_0000449631:p.Lys9Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain K A 22 P0DTD1-PRO_0000449631:p.Lys61Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain K A 22 P0DTD1-PRO_0000449631:p.Lys139Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain K A 22 ecoli Escherichia coli (strain K12) 5 enzyme target enzyme target substrate substrate neutral component neutral component 5'-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 9 stimulator stimulator neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) rna cleavage rna cleavage SF1, 4b More extensive degradation was observed when LS2U RNA was annealed to an unlabeled 40-nt template strand (LS15A_RNA) to generate a double-stranded (ds) RNA with a 20-nt 5'-overhang ls2u rna-nsp10_nsp14_sars2_1-2 3 8 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 20 enzyme enzyme neutral component neutral component purified purified ExoN domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 5 enzyme target enzyme target substrate substrate neutral component neutral component 5'-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) rna cleavage rna cleavage 1a, 1b, Lane 5 When DNA was used as the template strand (LS15_DNA; Table 1) to generate an RNA/DNA heteroduplex substrate, activity was observed but weaker than for dsRNA. nsp10-nsp14_sars2-1 SARS-CoV-2 3'-5' exoribonuclease proof-reading complex NSP10:NSP14 SARS-CoV-2 NSP14/NSP10 complex 7 enzyme enzyme nsp10 binding region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 12 unspecified role unspecified role nsp14 binding region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 78 80 physical association physical association SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV stable complex stable complex physical interaction evidence used in manual assertion physical interaction evidence used in manual assertion IPI inferred from physical interaction The SARS-CoV-2 coronavirus 3'-5' exoribonuclease complex which strictly targets double-stranded RNA and can selectively remove a mismatched ribonucleotide at the 3'-end of a dsRNA substrate. Formation of the NSP10-NSP14 complex strongly enhances the exonuclease activity of the bifunctional NSP14 and enhances the fidelity of RNA synthesis by correcting nucleotide incorporation errors made by the RNA-dependent RNA polymerase. May bind to, and act with the nsp7/nsp8/nsp12 polymerase complex (CPX-5742). Proof-reading exonuclease activity may explain why coronaviruses have the largest RNA genomes known to date. Complex formation does not appear to effect the C-terminal N7-methyltransferase activity of NSP14 involved in RNA cap modification. Severe acute respiratory syndrome (SARS) [EFO:0000694]: A viral respiratory infection caused by the SARS coronavirus. It is transmitted through close person-to-person contact. It is manifested with high fever, headache, dry cough and myalgias. It may progress to pneumonia and cause death. NSP10 forms a homododecamer in isolation. A flexible N-terminal domain of NSP14 forms the NSP10 docking site and induces conformational changes in the NSP14 that modulate the distance between the catalytic residues. New version remark: PMID:29279395 describes nsp14 as a 3'-5'-exoribonuclease. See also review PMID:31440227. Description, properties and xrefs updated and GO added as per Sandra's addition on SARS-CoV entry EBI-25496027/CPX-5707. Also updated this entry to "by orthology" as SARS-CoV has exp-evidence. Accepted 2020-APR-20 by ORCHARD coronavirus nsp10-nsp14_cvhsa SARS-CoV 3'-5' exoribonuclease proof-reading complex NSP10:NSP14 SARS-CoV NSP14/NSP10 complex 10 enzyme enzyme nsp10 binding region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role nsp14 binding region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 81 83 physical association physical association sars-cov Human SARS coronavirus SARS-CoV Severe acute respiratory syndrome coronavirus stable complex stable complex physical interaction evidence used in manual assertion physical interaction evidence used in manual assertion IPI inferred from physical interaction The SARS-CoV coronavirus 3'-5' exoribonuclease complex which strictly targets double-stranded RNA and can also selectively remove a mismatched ribonucleotide at the 3'-end of a dsRNA substrate. Formation of the NSP10-NSP14 complex strongly enhances the exonuclease activity of the bifunctional NSP14 and enhances the fidelity of RNA synthesis by correcting nucleotide incorporation errors made by the RNA-dependent RNA polymerase. May bind to, and act with the nsp7/nsp8/nsp12 polymerase complex (CPX-5717). Proof-reading exonuclease activity may explain why coronaviruses have the largest RNA genomes known to date. Complex formation does not appear to effect the C-terminal N7-methyltransferase activity of NSP14 involved in RNA cap modification. Severe acute respiratory syndrome (SARS) [EFO:0000694]: A viral respiratory infection caused by the SARS coronavirus. It is transmitted through close person-to-person contact. It is manifested with high fever, headache, dry cough and myalgias. It may progress to pneumonia and cause death. Heterodimer NSP10 forms a homododecamer in isolation. A flexible N-terminal domain of NSP14 forms the NSP10 docking site and induces conformational changes in the NSP14 that modulate the distance between the catalytic residues. Accepted 2020-APR-20 by ORCHARD coronavirus