IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Genomic RNA Elements Drive Phase Separation of the SARS-CoV-2 Nucleocapsid. Genomic RNA Elements Drive Phase Separation of the SARS-CoV-2 Nucleocapsid. Molecular cell 2020 imex curation Iserman C., Roden CA., Boerneke MA., Sealfon RSG., McLaughlin GA., Jungreis I., Fritch EJ., Hou YJ., Ekena J., Weidmann CA., Theesfeld CL., Kellis M., Troyanskaya OG., Baric RS., Sheahan TP., Weeks KM., Gladfelter AS. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus amyglad@unc.edu Only protein-protein interactions imex curation in vitro In vitro frap fluorescence recovery after photobleaching frap predetermined predetermined participant predetermined Iserman C., Roden CA., Boerneke MA., Sealfon RSG., McLaughlin GA., Jungreis I., Fritch EJ., Hou YJ., Ekena J., Weidmann CA., Theesfeld CL., Kellis M., Troyanskaya OG., Baric RS., Sheahan TP., Weeks KM., Gladfelter AS. Virus - Publications including interactions involving viral proteins amyglad@unc.edu Accepted 2021-JUL-04 AT 11:18 BST AT 11:18 BST by KALPANAP Molecular cell 2020 Only protein-protein interactions imex curation imex curation Genomic RNA Elements Drive Phase Separation of the SARS-CoV-2 Nucleocapsid. Genomic RNA Elements Drive Phase Separation of the SARS-CoV-2 Nucleocapsid. Molecular cell 2020 imex curation Iserman C., Roden CA., Boerneke MA., Sealfon RSG., McLaughlin GA., Jungreis I., Fritch EJ., Hou YJ., Ekena J., Weidmann CA., Theesfeld CL., Kellis M., Troyanskaya OG., Baric RS., Sheahan TP., Weeks KM., Gladfelter AS. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus amyglad@unc.edu Only protein-protein interactions imex curation human-293 Homo sapiens transformed primary embryonal kidney cells Human 293 Transformed human primary embryonal kidney cells. The Cell type named 293 is synonymous with HEK-293. frap fluorescence recovery after photobleaching frap tag fluorescence tag visualisation by fluorescence tag fluorescence Iserman C., Roden CA., Boerneke MA., Sealfon RSG., McLaughlin GA., Jungreis I., Fritch EJ., Hou YJ., Ekena J., Weidmann CA., Theesfeld CL., Kellis M., Troyanskaya OG., Baric RS., Sheahan TP., Weeks KM., Gladfelter AS. Virus - Publications including interactions involving viral proteins amyglad@unc.edu Accepted 2021-JUL-04 AT 11:18 BST AT 11:18 BST by KALPANAP Molecular cell 2020 Only protein-protein interactions imex curation imex curation Genomic RNA Elements Drive Phase Separation of the SARS-CoV-2 Nucleocapsid. Genomic RNA Elements Drive Phase Separation of the SARS-CoV-2 Nucleocapsid. Molecular cell 2020 imex curation Iserman C., Roden CA., Boerneke MA., Sealfon RSG., McLaughlin GA., Jungreis I., Fritch EJ., Hou YJ., Ekena J., Weidmann CA., Theesfeld CL., Kellis M., Troyanskaya OG., Baric RS., Sheahan TP., Weeks KM., Gladfelter AS. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus amyglad@unc.edu Only protein-protein interactions imex curation in vitro In vitro crosslink cross-linking study crosslink nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence Iserman C., Roden CA., Boerneke MA., Sealfon RSG., McLaughlin GA., Jungreis I., Fritch EJ., Hou YJ., Ekena J., Weidmann CA., Theesfeld CL., Kellis M., Troyanskaya OG., Baric RS., Sheahan TP., Weeks KM., Gladfelter AS. Virus - Publications including interactions involving viral proteins I do not think this method identifies which protein residue is X-linked. RNP-MaP: lysine residues are selectively crosslinked to proximal RNA nucleotides ;see PMID: 33077962. Crosslinker - S.D.A. (NHS-diazirine) rapidly labels RNA nucleotides at sites of protein binding on exposure to UV light. Crosslinked proteins were digested to short peptide adducts and after RNA isolation, followed by treatment with a MaP -a reverse transcriptase that incorporates non-templated nucleotides into the product DNA at the site of RNA–protein crosslinks. DNA sequencing follows. amyglad@unc.edu Accepted 2021-JUL-04 AT 11:18 BST AT 11:18 BST by KALPANAP Molecular cell 2020 Only protein-protein interactions imex curation imex curation Genomic RNA Elements Drive Phase Separation of the SARS-CoV-2 Nucleocapsid. Genomic RNA Elements Drive Phase Separation of the SARS-CoV-2 Nucleocapsid. Molecular cell 2020 imex curation Iserman C., Roden CA., Boerneke MA., Sealfon RSG., McLaughlin GA., Jungreis I., Fritch EJ., Hou YJ., Ekena J., Weidmann CA., Theesfeld CL., Kellis M., Troyanskaya OG., Baric RS., Sheahan TP., Weeks KM., Gladfelter AS. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus amyglad@unc.edu Only protein-protein interactions imex curation human-293 Homo sapiens transformed primary embryonal kidney cells Human 293 Transformed human primary embryonal kidney cells. The Cell type named 293 is synonymous with HEK-293. fluorescence imaging fluorescence microscopy fluorescence imaging tag fluorescence tag visualisation by fluorescence tag fluorescence Iserman C., Roden CA., Boerneke MA., Sealfon RSG., McLaughlin GA., Jungreis I., Fritch EJ., Hou YJ., Ekena J., Weidmann CA., Theesfeld CL., Kellis M., Troyanskaya OG., Baric RS., Sheahan TP., Weeks KM., Gladfelter AS. Virus - Publications including interactions involving viral proteins amyglad@unc.edu Accepted 2021-JUL-04 AT 11:18 BST AT 11:18 BST by KALPANAP Molecular cell 2020 Only protein-protein interactions imex curation imex curation Genomic RNA Elements Drive Phase Separation of the SARS-CoV-2 Nucleocapsid. Genomic RNA Elements Drive Phase Separation of the SARS-CoV-2 Nucleocapsid. Molecular cell 2020 imex curation Iserman C., Roden CA., Boerneke MA., Sealfon RSG., McLaughlin GA., Jungreis I., Fritch EJ., Hou YJ., Ekena J., Weidmann CA., Theesfeld CL., Kellis M., Troyanskaya OG., Baric RS., Sheahan TP., Weeks KM., Gladfelter AS. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus amyglad@unc.edu Only protein-protein interactions imex curation in vitro In vitro fluorescence imaging fluorescence microscopy fluorescence imaging predetermined predetermined participant predetermined N protein molar molar M M 4um RNA molar molar M M 25nm RNA molar molar M M 0.5-50nm N protein molar molar M M 2-4um N protein molar molar M M 2um RNA molar molar M M 50nm N protein molar molar M M 1um RNA molar molar M M 5nm Iserman C., Roden CA., Boerneke MA., Sealfon RSG., McLaughlin GA., Jungreis I., Fritch EJ., Hou YJ., Ekena J., Weidmann CA., Theesfeld CL., Kellis M., Troyanskaya OG., Baric RS., Sheahan TP., Weeks KM., Gladfelter AS. Virus - Publications including interactions involving viral proteins I have not added Supp. figs 2D + E as it is not clear what the interactors are. Similarly RHS image for figure 2G. There will appear to be lots of duplicate interactions;however the amounts of protein differ as given in Variable conditions or comments. Also tags vary - some have tags on both proteins, other identical interactions only on one. amyglad@unc.edu Accepted 2021-JUL-04 AT 11:18 BST AT 11:18 BST by KALPANAP Molecular cell 2020 Only protein-protein interactions imex curation imex curation ncap_sars2 Nucleoprotein N Nucleocapsid protein protein protein SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV MSDNGPQNQRNAPRITFGGPSDSTGSNQNGERSGARSKQRRPQGLPNNTASWFTALTQHGKEDLKFPRGQGVPINTNSSPDDQIGYYRRATRRIRGGDGKMKDLSPRWYFYYLGTGPEAGLPYGANKDGIIWVATEGALNTPKDHIGTRNPANNAAIVLQLPQGTTLPKGFYAEGSRGGSQASSRSSSRSRNSSRNSTPGSSRGTSPARMAGNGGDAALALLLLDRLNQLESKMSGKGQQQQGQTVTKKSAAEASKKPRQKRTATKAYNVTQAFGRRGPEQTQGNFGDQELIRQGTDYKHWPQIAQFAPSASAFFGMSRIGMEVTPSGTWLTYTGAIKLDDKDPNFKDQVILLNKHIDAYKTFPPTEPKKDKKKKADETQALPQRQKKQQTVTLLPAADLDDFSKQLQQSMSSADSTQA 387 additional nucleotides rna ribonucleic acid RNA rna in vitro In vitro CTAGAAGATCTCCTACAATATTCTCAGCTGCCATGGAAAATCGATGTTCTTCTTTTATTCTCTCAAGATTTTCAGGCTGTATATTAAAACTTATATTAAGAACTATGCTAACCACCTCATCAGGAACCGTTGTAGGTGGCGTGGGTTTTCTTGGCAATCGACTCTCATGAAAACTACGAGCTAAATATTCAATATGTTCCTCTTGACCAACTTTATTCTGCATTTTTTTTGAACGAGGTTTAGAGCAAGCTTCAGGAAACTGAGACAGGAATTTTATTAAAAATTTAAATTTTGAAGAAAGTTCAGGGTTAATAGCATCCATTTTTTGCTTTGCAAGTTCCTCAGCATTCTTAACAAAAGACGTCTCTTTTGACATGTTTAAAGTTT genomic_rna rna ribonucleic acid RNA rna SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV anti-sense frame shifting region rna ribonucleic acid RNA rna in vitro In vitro ACACTGTAGAGAATAAAACATTAAAGTTTGCACAATGCAGAATGCATCTGTCATCCAAACAGTTAACACAATTTGGGTGGTATGTCTGATCCCAATATTTAAAATAACGGTCAAAGAGTTTTAACCTCTCTTCCGTGAAGTCATATTTTAACAAATCCCACTTAATGTAAGGCTTTGTTAAGTCAGTGTCAACATGTGACTCTGCAGTTAAAGCCCTGGTCAAGGTTAATATAGGCATTAACAATGAATAATAAGAATCTACAACAGGAACTCCACTACCTGGCGTGGTTTGTATGAAATCACCGAAATCATACCAGTTACCATTGAGATCTTGATTATCTAATGTCAGTACACCAACAATACCAGCATTTCGCATGGCATCACAGAATTGTACTGTTTTTAACAAAGCTTGGCGTACACGTTCACCTAAGTTGGCGTATACGCGTAATATATCTGGGTTTTCTACAAAATCATACCAGTCCTTTTTATTGAAATAATCATCATCACAACAATTGTATGTGACAAGTATTTCTTTTAATGTGTCACAATTACCTTCATCAAAATGCCTTAAAGCATAGACGAGGTCTGCCATTGTGTATTTAGTAAGACGTTGACGTGATATATGTGGTACCATGTCACCGTCTATTCTAAACTTAAAGAAGTCATGTTTAGCAACAGCTGGACAATCCTTAAGTAAATTATAAATTGTTTCTTCATGTTGGTAGTTAGAGAAAGTGTGTCTCTTAACTACAAAGTAAGAATCAATTAAATTGTCATCTTCGTCCTTTTCTTGGAAGCGACAACAATTAGTTTTTAGGAATTTAGCAAAACCAGCTACTTTATCATTGTAGATGTCAAAAGCCCTGTATACGACATCAGTACTAGTGCCTGTGCCGCACGGTGTAAGACGGGCTGCACTTACACCGCAAACCCGTTTAAAAACGATTGTGCATCAGCTGACTGAAGCATSGGGTTCGCGGAGTTGATCACAACTACAGCCA 1988 additional nucleotides rna ribonucleic acid RNA rna in vitro In vitro CTAGAAGATCTCCTACAATATTCTCAGCTGCCATGGAAAATCGATGTTCTTCTTTTATTCTCTCAAGATTTTCAGGCTGTATATTAAAACTTATATTAAGAACTATGCTAACCACCTCATCAGGAACCGTTGTAGGTGGCGTGGGTTTTCTTGGCAATCGACTCTCATGAAAACTACGAGCTAAATATTCAATATGTTCCTCTTGACCAACTTTATTCTGCATTTTTTTTGAACGAGGTTTAGAGCAAGCTTCAGGAAACTGAGACAGGAATTTTATTAAAAATTTAAATTTTGAAGAAAGTTCAGGGTTAATAGCATCCATTTTTTGCTTTGCAAGTTCCTCAGCATTCTTAACAAAAGACGTCTCTTTTGACATGTTTAAAGTTTAAACCTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCAATTGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGAT grna-n-1 5 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component infection infection conditioned medium conditioned medium chlae-vero_e6 chlae-vero_e6 cells vero_e6 vero_e6 cell epithelium Epithelium [epithelial cells] direct interaction direct interaction 1B genomic_rna-n-1 5 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined human-293 Homo sapiens transformed primary embryonal kidney cells Human 293 Transformed human primary embryonal kidney cells. The Cell type named 293 is synonymous with HEK-293. 16 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro direct interaction direct interaction Supp. figure 1A, LHS No His-tag on N protein. genomic_rna-n-2 5 14 unspecified role unspecified role neutral component neutral component purified purified ptms modres protein modification ModRes undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined decreasing-ptm ptm decreasing an interaction decreasing-ptm c-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range human-293 Homo sapiens transformed primary embryonal kidney cells Human 293 Transformed human primary embryonal kidney cells. The Cell type named 293 is synonymous with HEK-293. 16 unspecified role unspecified role neutral component neutral component infection infection conditioned medium conditioned medium region cy3 label cy3 label undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro direct interaction direct interaction Supp. figure 1A, RHS, 1B genomic_rna-n-3 5 14 unspecified role unspecified role neutral component neutral component purified purified ptms modres protein modification ModRes undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined increasing-ptm ptm increasing an interaction increasing-ptm n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component infection infection conditioned medium conditioned medium region cy3 label cy3 label undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro direct interaction direct interaction Supp. figure 1B Unmodified protein (with less ptms) yielded larger, more abundant droplets. genomic_rna-n-4 5 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component frameshifting region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro direct interaction direct interaction 7 6 1F, Supp. figure 1E N-protein at 4 uM. RNA concentration 25nm. The frameshifting region promoted LLPS only within a narrow protein and RNA concentration range. genomic_rna-n-5 5 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Tyr109Ala mutation increasing strength mutation increasing interaction strength mutation increasing strength certain certain sequence position certain certain certain sequence position certain Y A Thu Apr 22 11:24:55 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Tyr109Ala' ecoli Escherichia coli (strain K12) 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Tyr109Ala mutation increasing strength mutation increasing interaction strength mutation increasing strength certain certain sequence position certain certain certain sequence position certain Y A Thu Apr 22 11:19:52 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Tyr109Ala' ecoli Escherichia coli (strain K12) direct interaction direct interaction 1E- RHS, 2A, 5A, Supp. figure 1D, 2A, 6 On figure 1E stated to be the "control" on the image, and assumed to be in the absence of RNA. N-protein at 1-2 uM;4 uM in figure 2A, not stated for figure S2A or 6. Increased temperature:N-protein alone, demixed into droplets in a temperature-dependent manner, highly pronounced at fever temperature (40°C) and above (45°C). genomic_rna-n-6 5 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain region cy3 label cy3 label undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 5' utr and nucleocaspid region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain in vitro In vitro direct interaction direct interaction 13 12 1E N-protein at 1 uM. RNA concentration 5nm. The 5′ end and the nucleocapsid RNAs promoted LLPS; the frameshifting region and the PS region RNAs reduced LLPS relative to N-protein alone. genomic_rna-n-7 5 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro direct interaction direct interaction 9 8 1F, Supp. figure 1D/E N-protein at 2-4 uM. RNA concentration 0.5-50 nm. 387 additional nucleotides-genomic_rna-2 5 15 stimulator stimulator neutral component neutral component in vitro In vitro 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component frameshifting region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro direct interaction direct interaction 13 10 1H N-protein at 2 uM. RNA concentration 5nm. Addition of 0.3 kb or 2.4 kb of non-viral sequence to the 1 kb 5′ end or frameshifting region RNAs resulted in a progressive increase in condensate size/number. 387 additional nucleotides-genomic_rna-1 5 15 stimulator stimulator neutral component neutral component in vitro In vitro 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro direct interaction direct interaction 13 10 1H N-protein at 2 uM. RNA concentration 5nm. Addition of 0.3 kb or 2.4 kb of non-viral sequence to the 1 kb 5′ end or frameshifting region RNAs resulted in a progressive increase in condensate size/number. 1988 additional nucleotides-genomic_rna-1 5 18 stimulator stimulator neutral component neutral component in vitro In vitro 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro direct interaction direct interaction 13 10 1H N-protein at 2 uM. RNA concentration 5nm. It is stated that the addition of 0.3 kb or 2.4 kb of non-viral sequence to the 1 kb 5′ end or frameshifting region RNAs resulted in a progressive increase in condensate size/number. 2.4 kb ?? - only 1988 residues 1988 additional nucleotides-genomic_rna-2 5 18 stimulator stimulator neutral component neutral component in vitro In vitro 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component frameshifting region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro direct interaction direct interaction 13 10 1H N-protein at 2 uM. RNA concentration 5nm. It is stated that the addition of 0.3 kb or 2.4 kb of non-viral sequence to the 1 kb 5′ end or frameshifting region RNAs resulted in a progressive increase in condensate size/number. is 1.988 kb added not 2.4? anti_sense frame shifting region-n-1 5 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 17 unspecified role unspecified role neutral component neutral component infection infection conditioned medium conditioned medium in vitro In vitro direct interaction direct interaction 7 6 1F, Supp. figure 1E N-protein at 4 uM. RNA concentration 25nm. I cannot enter the anti-sense region as part of NC_045512.2 although bar an extraneous "S" residue it maps exactly. genomic_rna-n-8 5 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 17 unspecified role unspecified role neutral component neutral component in vitro In vitro direct interaction direct interaction 7 6 Supp. figure 1E genomic_rna-n-9 5 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro direct interaction direct interaction 13 12 Supp. figure 1F N-protein at 1 uM. RNA concentration 5 nm. When combined with 5′ end RNA, total lung RNA (2.75 ng/ul) synergized with the 5′ end increasing the condensate size, number, and viral RNA enrichment. genomic_rna-n-10 5 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain region cy3 label cy3 label undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 5' utr and nucleocaspid region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain in vitro In vitro direct interaction direct interaction 7 6 2A. Lowering of the temperature;addition of the 5′ end RNA lowered the most efficient condensation temperatures to 37°C and 33°C, from 40-45 degrees for the N protein alone. Supp. fig 2A/C has NO tag on the RNA. Fig. 2A does. genomic_rna-n-11 5 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 5' utr and nucleocaspid region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain in vitro In vitro direct interaction direct interaction 7 6 Supp. figure 2 A/C Lowering of the temperature;addition of the 5′ end RNA lowered the most efficient condensation temperatures to 37°C and 33°C, from 40-45 degrees for the N protein alone. This effect was independent of RNA sequence. genomic_rna-n-13 5 16 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain region cy5 label cy5 label undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain region cy3 label cy3 label undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 5' utr and nucleocaspid region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain in vitro In vitro physical association physical association 2E 5′ end RNA (cy5 tag) readily mixed into preformed N-protein-5′ end (cy3 tag) condensates; in contrast, subgenomic nucleocapsid RNA was excluded from the preformed 5′ end droplets. I have not added Supp. figs 2D + E as it is not clear what the interactors are. Nor RHS image for figure 2G. genomic_rna-n-14 5 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain region cy3 label cy3 label undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro direct interaction direct interaction 2G -LHS RNA concentration 50nm. N protein concentration not stated. genomic_rna-n-16 5 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Tyr109Ala mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain Y A Thu Apr 22 11:06:35 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Tyr109Ala' ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro direct interaction direct interaction 5A RNA at 5-50nm, N protein concentration not stated. n-n-47 4 14 unspecified role unspecified role neutral component neutral component over-expressed over expressed level over-expressed P0DTC9:p.Gly335Ala mutation mutation certain certain sequence position certain certain certain sequence position certain G A Thu Apr 22 11:04:30 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly335Ala' C-terminus gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range 14 unspecified role unspecified role neutral component neutral component over-expressed over expressed level over-expressed C-terminus gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range P0DTC9:p.Gly335Ala mutation mutation certain certain sequence position certain certain certain sequence position certain G A Thu Apr 22 10:47:05 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly335Ala' colocalization colocalization 6 A-D, K Results suggest that N-protein forms cytoplasmic, liquid-like condensates in cells. Kanamycin caused relocalization of N-GFP to the cell nucleus. n-n-48 2 14 unspecified role unspecified role neutral component neutral component over-expressed over expressed level over-expressed P0DTC9:p.Gly335Ala mutation mutation certain certain sequence position certain certain certain sequence position certain G A Thu Apr 22 10:26:13 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly335Ala' C-terminus gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range 14 unspecified role unspecified role neutral component neutral component over-expressed over expressed level over-expressed C-terminus gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range P0DTC9:p.Gly335Ala mutation mutation certain certain sequence position certain certain certain sequence position certain G A Thu Apr 22 10:41:11 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly335Ala' physical association physical association 6 E/F N-protein droplets readily underwent fusion and recovered partially following FRAP. genomic_rna-n-17 5 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component frameshifting region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain region cy3 label cy3 label undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro direct interaction direct interaction 6 G-J, Supp. figure 7 N-protein and RNA concentrations not stated. The frameshifting region promoted LLPS only within a narrow protein and RNA concentration range. 1,6-hexanediol (CHEBI:43078 ) lipoic acid (CHEBI:16494) kanamycin (CHEBI:6104) genomic_rna-n-18 3 14 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range p.Tyr109Ala mutation with complex effect mutation with complex effect certain certain sequence position certain certain certain sequence position certain Y A ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component in vitro In vitro direct interaction direct interaction Figure 3,4,5, Supp. figure 4 N-protein interacts specifically with a few preferred sites in the 5′ end in both diffuse and condensed states and interacts more homogeneously across the frameshifting region. The PS region is homogeneously coated with N-protein in both diffuse and condensed states, similar to the frameshifting region. Nucleocapsid RNA:there are few N-protein interactions. RNA 50nm, N protein 4uM for the Frameshifting region. 25-50nm RNA and 4uM for 5' end. genomic_rna-n-15 1 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 5' utr and nucleocaspid region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain in vitro In vitro direct interaction direct interaction Supp. figure 2B N-protein signal recovered faster in 5′ end RNA droplets than in nucleocapsid RNA droplets. genomic_rna-n-12 5 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component frameshifting region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain region cy3 label cy3 label undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro direct interaction direct interaction 7 6 Supp. figure 4 genomic_rna-n-19 5 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain region cy3 label cy3 label undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro direct interaction direct interaction 11 7 6 Supp. figure 4 genomic_rna-n-20 5 14 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Tyr109Ala mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain Y A Thu Apr 22 11:22:36 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Tyr109Ala' ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component frameshifting region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro direct interaction direct interaction Supp. figure 6 N-protein concentration not stated;RNA 15 and 25nM. The frameshifting region promoted LLPS only within a narrow protein and RNA concentration range.