IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Nuclear miRNA regulates the mitochondrial genome in the heart. Nuclear miRNA regulates the mitochondrial genome in the heart. Circulation research 2012 imex curation Das S., Ferlito M., Kent OA., Fox-Talbot K., Wang R., Liu D., Raghavachari N., Yang Y., Wheelan SJ., Murphy E., Steenbergen C. csteenb1@jhmi.edu Only protein-protein interactions imex curation rat-myocytes Rattus norvegicus myocytes myocytes rna-ip rna immunoprecipitation rna-ip qrt-pcr quantitative reverse transcription pcr QRT-PCR Das S., Ferlito M., Kent OA., Fox-Talbot K., Wang R., Liu D., Raghavachari N., Yang Y., Wheelan SJ., Murphy E., Steenbergen C. csteenb1@jhmi.edu Accepted 2021-OCT-05 AT 12:57 BST AT 12:57 BST by ORCHARD Circulation research 2012 Only protein-protein interactions imex curation imex curation rno-mir-181c-5p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA rat Rattus norvegicus (Rat) Rat AACAUUCAACCUGUCGGUGAGU ago2_rat Protein argonaute-2 Ago2 Argonaute RISC catalytic component 2 Eif2c2 Eukaryotic translation initiation factor 2C 2 Golgi ER protein 95 kDa Protein slicer protein protein rat Rattus norvegicus (Rat) Rat MYSGAGPVLASPAPTTSPIPGYAFKPPPRPDFGTTGRTIKLQANFFEMDIPKIDIYHYELDIKPEKCPRRVNREIVEHMVQHFKTQIFGDRKPVFDGRKNLYTAMPLPIGRDKVELEVTLPGEGKDRIFKVSIKWVSCVSLQALHDALSGRLPSVPFETIQALDVVMRHLPSMRYTPVGRSFFTASEGCSNPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFVCEVLDFKSIEEQQKPLTDSQRVKFTKEIKGLKVEITHCGQMKRKYRVCNVTRRPASHQTFPLQQESGQTVECTVAQYFKDRHKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLMRSASFNTDPYVREFGIMVKDEMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTEVHLKSFTEQLRKISRDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPNRYCATVRVQQHRQEIIQDLAAMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFQQVLHHELLAIREACIKLEKEYQPGITFIVVQKRHHTRLFCTDKNERVGKSGNIPAGTTVDTKITHPTEFDFYLCSHAGIQGTSRPSHYHVLWDDNRFSSDELQILTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHTSGQSNGRDHQALAKAVQVHQDTLRTMYFA mrna_cox1_rat mitochondrially encoded cytochrome c oxidase I mrna messenger rna mRNA mrna rat Rattus norvegicus (Rat) Rat ago2-rno_mir_181c_5p-1 1 3 antibody detection identification by antibody antibody detection qrt-pcr quantitative reverse transcription pcr QRT-PCR unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level 4 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level 2 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 3 B, C, suppl fig 9