IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Transcriptional activation of the miR-17-92 cluster is involved in the growth-promoting effects of MYB in human Ph-positive leukemia cells. Transcriptional activation of the miR-17-92 cluster is involved in the growth-promoting effects of MYB in human Ph-positive leukemia cells. Haematologica 2019 imex curation Spagnuolo M., Regazzo G., De Dominici M., Sacconi A., Pelosi A., Korita E., Marchesi F., Pisani F., Magenta A., Lulli V., Cordone I., Mengarelli A., Strano S., Blandino G., Rizzo MG., Calabretta B. maria.rizzo@ifo.gov.it 09-May-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-bv173r BV173R- Human imatinib –resistant variant of BV173 expressing T315I mutation Bcr/Abl bv173r BV173R- Human, imatinib –resistant variant of BV173 expressing T315I mutation Bcr/Abl derived from a patient with CML in lymphoblastic crisis ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Spagnuolo M., Regazzo G., De Dominici M., Sacconi A., Pelosi A., Korita E., Marchesi F., Pisani F., Magenta A., Lulli V., Cordone I., Mengarelli A., Strano S., Blandino G., Rizzo MG., Calabretta B. maria.rizzo@ifo.gov.it Accepted 2019-MAR-25 AT 19:56 GMT AT 19:56 GMT by PPORRAS Haematologica 2019 Only protein-protein interactions imex curation imex curation I have added the binding region as a comment because the range depends on where the gene sequence starts Transcriptional activation of the miR-17-92 cluster is involved in the growth-promoting effects of MYB in human Ph-positive leukemia cells. Transcriptional activation of the miR-17-92 cluster is involved in the growth-promoting effects of MYB in human Ph-positive leukemia cells. Haematologica 2019 imex curation Spagnuolo M., Regazzo G., De Dominici M., Sacconi A., Pelosi A., Korita E., Marchesi F., Pisani F., Magenta A., Lulli V., Cordone I., Mengarelli A., Strano S., Blandino G., Rizzo MG., Calabretta B. maria.rizzo@ifo.gov.it 09-May-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. mirna interference luciferase assay miRNA interference luciferase reporter assay miRNA interference luciferase assay tag luciferase tag visualisation by luciferase assay tag luciferase Spagnuolo M., Regazzo G., De Dominici M., Sacconi A., Pelosi A., Korita E., Marchesi F., Pisani F., Magenta A., Lulli V., Cordone I., Mengarelli A., Strano S., Blandino G., Rizzo MG., Calabretta B. maria.rizzo@ifo.gov.it Accepted 2019-MAR-25 AT 19:56 GMT AT 19:56 GMT by PPORRAS Haematologica 2019 Only protein-protein interactions imex curation imex curation I have added the binding region as a comment because the range depends on where the gene sequence starts Transcriptional activation of the miR-17-92 cluster is involved in the growth-promoting effects of MYB in human Ph-positive leukemia cells. Transcriptional activation of the miR-17-92 cluster is involved in the growth-promoting effects of MYB in human Ph-positive leukemia cells. Haematologica 2019 imex curation Spagnuolo M., Regazzo G., De Dominici M., Sacconi A., Pelosi A., Korita E., Marchesi F., Pisani F., Magenta A., Lulli V., Cordone I., Mengarelli A., Strano S., Blandino G., Rizzo MG., Calabretta B. maria.rizzo@ifo.gov.it 09-May-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-k_562 Homo sapiens myeloid leukemia cells. k562 Myelogenous leukemia K562 cells ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Spagnuolo M., Regazzo G., De Dominici M., Sacconi A., Pelosi A., Korita E., Marchesi F., Pisani F., Magenta A., Lulli V., Cordone I., Mengarelli A., Strano S., Blandino G., Rizzo MG., Calabretta B. maria.rizzo@ifo.gov.it Accepted 2019-MAR-25 AT 19:56 GMT AT 19:56 GMT by PPORRAS Haematologica 2019 Only protein-protein interactions imex curation imex curation I have added the binding region as a comment because the range depends on where the gene sequence starts myb_human Transcriptional activator Myb MYB Proto-oncogene c-Myb protein protein human Homo sapiens Human MARRPRHSIYSSDEDDEDFEMCDHDYDGLLPKSGKRHLGKTRWTREEDEKLKKLVEQNGTDDWKVIANYLPNRTDVQCQHRWQKVLNPELIKGPWTKEEDQRVIELVQKYGPKRWSVIAKHLKGRIGKQCRERWHNHLNPEVKKTSWTEEEDRIIYQAHKRLGNRWAEIAKLLPGRTDNAIKNHWNSTMRRKVEQEGYLQESSKASQPAVATSFQKNSHLMGFAQAPPTAQLPATGQPTVNNDYSYYHISEAQNVSSHVPYPVALHVNIVNVPQPAAAAIQRHYNDEDPEKEKRIKELELLLMSTENELKGQQVLPTQNHTCSYPGWHSTTIADHTRPHGDSAPVSCLGEHHSTPSLPADPGSLPEESASPARCMIVHQGTILDNVKNLLEFAETLQFIDSFLNTSSNHENSDLEMPSLTSTPLIGHKLTVTTPFHRDQTVKTQKENTVFRTPAIKRSILESSPRTPTPFKHALAAQEIKYGPLKMLPQTPSHLVEDLQDVIKQESDESGIVAEFQENGPPLLKKIKQEVESPTDKSGNFFCSHHWEGDSLNTQLFTQTSPVADAPNILTSSVLMAPASEDEDNVLKAFTVPKNRSLASPLQPCSSTWEPASCGKMEEQMTSSSQARKYVNAFSARTLVM DIP protein P10242 original sequence version: 144 DIP protein P10242 original sequence version: 133 DIP protein P10242 original sequence version: 157 FD5E6694020426ED ada_gene adenosine deaminase gene gene human Homo sapiens Human hsa-mir-17 gene gene gene human Homo sapiens Human hsa-mir-19a-3p microRNA hsa-miR-19a-3p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human UGUGCAAAUCUAUGCAAAACUGA mrna_frzt frizzled related protein [ mrna messenger rna mRNA mrna human Homo sapiens Human ACTTGCAGCGGGGGAGGCGGAGACGGCGGAGCGGGCCTTTTGGCGTCCACTGCGCGGCTGCACCCTGCCCCATCCTGCCGGGATCATGGTCTGCGGCAGCCCGGGAGGGATGCTGCTGCTGCGGGCCGGGCTGCTTGCCCTGGCTGCTCTCTGCCTGCTCCGGGTGCCCGGGGCTCGGGCTGCAGCCTGTGAGCCCGTCCGCATCCCCCTGTGCAAGTCCCTGCCCTGGAACATGACTAAGATGCCCAACCACCTGCACCACAGCACTCAGGCCAACGCCATCCTGGCCATCGAGCAGTTCGAAGGTCTGCTGGGCACCCACTGCAGCCCCGATCTGCTCTTCTTCCTCTGTGCCATGTACGCGCCCATCTGCACCATTGACTTCCAGCACGAGCCCATCAAGCCCTGTAAGTCTGTGTGCGAGCGGGCCCGGCAGGGCTGTGAGCCCATACTCATCAAGTACCGCCACTCGTGGCCGGAGAACCTGGCCTGCGAGGAGCTGCCAGTGTACGACAGGGGCGTGTGCATCTCTCCCGAGGCCATCGTTACTGCGGACGGAGCTGATTTTCCTATGGATTCTAGTAACGGAAACTGTAGAGGGGCAAGCAGTGAACGCTGTAAATGTAAGCCTATTAGAGCTACACAGAAGACCTATTTCCGGAACAATTACAACTATGTCATTCGGGCTAAAGTTAAAGAGATAAAGACTAAGTGCCATGATGTGACTGCAGTAGTGGAGGTGAAGGAGATTCTAAAGTCCTCTCTGGTAAACATTCCACGGGACACTGTCAACCTCTATACCAGCTCTGGCTGCCTCTGCCCTCCACTTAATGTTAATGAGGAATATATCATCATGGGCTATGAAGATGAGGAACGTTCCAGATTACTCTTGGTGGAAGGCTCTATAGCTGAGAAGTGGAAGGATCGACTCGGTAAAAAAGTTAAGCGCTGGGATATGAAGCTTCGTCATCTTGGACTCAGTAAAAGTGATTCTAGCAATAGTGATTCCACTCAGAGTCAGAAGTCTGGCAGGAACTCGAACCCCCGGCAAGCACGCAACTAAATCCCGAAATACAAAAAGTAACACAGTGGACTTCCTATTAAGACTTACTTGCATTGCTGGACTAGCAAAGGAAAATTGCACTATTGCACATCATATTCTATTGTTTACTATAAAAATCATGTGATAACTGATTATTACTTCTGTTTCTCTTTTGGTTTCTGCTTCTCTCTTCTCTCAACCCCTTTGTAATGGTTTGGGGGCAGACTCTTAAGTATATTGTGAGTTTTCTATTTCACTAATCATGAGAAAAACTGTTCTTTTGCAATAATAATAAATTAAACATGCTGTTACCAGAGCCTCTTTGCTGGAGTCTCCAGATGTTAATTTACTTTCTGCACCCCAATTGGGAATGCAATATTGGATGAAAAGAGAGGTTTCTGGTATTCACAGAAAGCTAGATATGCCTTAAAACATACTCTGCCGATCTAATTACAGCCTTATTTTTGTATGCCTTTTGGGCATTCTCCTCATGCTTAGAAAGTTCCAAATGTTTATAAAGGTAAAATGGCAGTTTGAAGTCAAATGTCACATAGGCAAAGCAATCAAGCACCAGGAAGTGTTTATGAGGAAACAACACCCAAGATGAATTATTTTTGAGACTGTCAGGAAGTAAAATAAATAGGAGCTTAAGAAAGAACATTTTGCCTGATTGAGAAGCACAACTGAAACCAGTAGCCGCTGGGGTGTTAATGGTAGCATTCTTCTTTTGGCAATACATTTGATTTGTTCATGAATATATTAATCAGCATTAGAGAAATGAATTATAACTAGACATCTGCTGTTATCACCATAGTTTTGTTTAATTTGCTTCCTTTTAAATAAACCCATTGGTGAAAGTCTTTTTTTTTCTCTTCTTTTAAAATAAATCAGAATTGCCGTATTGACCAGGAAAAGATTATGTATGCACGTGCACCAGGGTTAGTTTTTAAAAGTACATGGCTCCATAAAAATGCTGTAGATTACAGAGTGATAAAATATGCAGGTTTTTTTGTTTTTGTTTTTTCTGTTGTGTGTGTGTCTGTATTTGTGTACATGTGTGTCCTTGCACTCACACCCAAGGTGGATTAAAATACAGGCCTGCAAACTGGCCTGCACTTTATCATTTGGATTTGTGCTGCTTAATGCTCAGCGAAAAATGTCTAGTAAAATGAATTATGGTTGTCAGGAGAGAGGTTATTTCGACTTTTGAACCAATTGCACATTTCTCATTACCCAAGCTGTGGTGAGATCCCAGGGGCTGTGGTGAACAAATGATGCTTTTATAGATGGTCCCTAGCTTACAATGATTCAATTTACAATGCTTCAATTTAACAATTTGTTGACTTACAATGGGTTTATCAGGATGTAACCCAATGCATTTCAACTTACGATATTTTCAGTTTCGAATGGGTTTATCCAGATGTAACCCCATCGTAAATGGCGGAGCATCTGTACTTCCTTCCTCTGGCAGAGTTCCTTAGAGCCTGTGCCAATTACTTGAAAGTTTCATTCTCTGCCATTTACATGTGTGCTATTAGTAGAACCAAATTTCTAAGCTGTGGCGTGCTGAAAATAAAATGCTTATGAAGCAAAAA hsa-mir-17-5p microRNA 17 5p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human CAAAGUGCUUACAGUGCAGGUAG hsa_mir_17 5p-mrna_frzt-1 2 9 predetermined predetermined participant predetermined tag luciferase tag visualisation by luciferase assay tag luciferase regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified 8 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined r.2156_2159delinsaagc mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain CACT AAGC physical association physical association Fig 4 F, Tab S1 down-regulates quantity by destabilization hsa_mir_19a 3p-mrna_frzt-1 2 7 predetermined predetermined participant predetermined tag luciferase tag visualisation by luciferase assay tag luciferase regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified 8 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined r.1139_1144delinsggtacc mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain TGCACT GGTACC physical association physical association Fig 4 F, Tab S1 down-regulates quantity by destabilization myb-hsa_mir_17 gene-1 1 4 antibody detection identification by antibody antibody detection q-pcr quantitative pcr q-pcr unspecified role unspecified role bait bait living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 6 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level promoter region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined The binding region is approximately 600-500 bp from the Transcription start site physical association physical association Fig 2 A, B myb-ada_gene-1 1 4 antibody detection identification by antibody antibody detection q-pcr quantitative pcr q-pcr unspecified role unspecified role bait bait living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 5 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level promoter region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined The binding region is approximately 600-500 bp from the Transcription start site physical association physical association Fig 2 A, B myb-hsa_mir_17 gene-3 3 4 antibody detection identification by antibody antibody detection q-pcr quantitative pcr q-pcr unspecified role unspecified role bait bait living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 6 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level promoter region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined The binding region is approximately 600-500 bp from the Transcription start site physical association physical association Fig 2 A, B myb-ada_gene-2 3 5 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level promoter region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined The binding region is approximately 600-500 bp from the Transcription start site 4 antibody detection identification by antibody antibody detection q-pcr quantitative pcr q-pcr unspecified role unspecified role bait bait living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Fig 2 A, B