IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Akt1 mediates the posterior Hoxc gene expression through epigenetic modifications in mouse embryonic fibroblasts. Akt1 mediates the posterior Hoxc gene expression through epigenetic modifications in mouse embryonic fibroblasts. Biochimica et biophysica acta 2014 imex curation Kong KA., Lee JY., Oh JH., Lee Y., Kim MH. I am not 100% sure what we are meant to be doing for ChIPs these days - I have made as "Physical Association". I have NOT and added the forward primer as "original sequence" - tables S2/3. Hope this is OK. Nothing relevant I can find in the Manual. I asked library to send supplement -they did, but am not much the wiser. mhkim1@yuhs.ac 21-Nov-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation mouse-embryonic_fibroblast Mus musculus embryonic fibroblasts embryonic_fibroblast Embryonic fibroblast Fibroblasts taken from an embryonic as opposed to a foetal or adult source. Foetus is defined as the stage at which tissue diferentiation is initiated. Tissue taken from an embryonic as opposed to a foetal or adult source. Embryo is defined as the development stage prior to organ formation. anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Kong KA., Lee JY., Oh JH., Lee Y., Kim MH. I am not 100% sure what we are meant to be doing for ChIPs these days - I have made as "Physical Association". I have NOT and added the forward primer as "original sequence" - tables S2/3. Hope this is OK. Nothing relevant I can find in the Manual. I asked library to send supplement -they did, but am not much the wiser. mhkim1@yuhs.ac Accepted 2019-OCT-04 AT 10:50 BST AT 10:50 BST by PPORRAS Biochimica et biophysica acta 2014 Only protein-protein interactions imex curation imex curation Akt1 mediates the posterior Hoxc gene expression through epigenetic modifications in mouse embryonic fibroblasts. Akt1 mediates the posterior Hoxc gene expression through epigenetic modifications in mouse embryonic fibroblasts. Biochimica et biophysica acta 2014 imex curation Kong KA., Lee JY., Oh JH., Lee Y., Kim MH. I am not 100% sure what we are meant to be doing for ChIPs these days - I have made as "Physical Association". I have NOT and added the forward primer as "original sequence" - tables S2/3. Hope this is OK. Nothing relevant I can find in the Manual. I asked library to send supplement -they did, but am not much the wiser. mhkim1@yuhs.ac 21-Nov-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation mouse-embryonic_fibroblast Mus musculus embryonic fibroblasts embryonic_fibroblast Embryonic fibroblast Fibroblasts taken from an embryonic as opposed to a foetal or adult source. Foetus is defined as the stage at which tissue diferentiation is initiated. Tissue taken from an embryonic as opposed to a foetal or adult source. Embryo is defined as the development stage prior to organ formation. ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Kong KA., Lee JY., Oh JH., Lee Y., Kim MH. I am not 100% sure what we are meant to be doing for ChIPs these days - I have made as "Physical Association". I have NOT and added the forward primer as "original sequence" - tables S2/3. Hope this is OK. Nothing relevant I can find in the Manual. I asked library to send supplement -they did, but am not much the wiser. mhkim1@yuhs.ac Accepted 2019-OCT-04 AT 10:50 BST AT 10:50 BST by PPORRAS Biochimica et biophysica acta 2014 Only protein-protein interactions imex curation imex curation hxc12_amplicon_1_mouse Mouse hxc12_gene_amplicon_1 (-2231) - (-1932) ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse GTCGGAAGGGAGGCTAAAATGGGGAGATCTACTCAACAAAGGCTAGTGGCTGACGGCAAAGCCAGCTCGAATCCCTCACAGCAACAATAGCGGCAGAGCGCCGAGGCCTGGAGAGCCTGGGCGTAGACATCGCTGCCAAGCGTAATGTGCTGATTGAAATCTGTAATGTTGAGATCACATCGCCTTTATCTTTATGATCAAAATGACTCCCAGATAATTTTTTAAAACTAGATGTTCATGTGCAATCAATGAGTCTTGAAAATGAAGAAATAAATGAAATTCAGCGATGGTATGACATGC kdm6a_mouse Lysine-specific demethylase 6A Ubiquitously transcribed X chromosome tetratricopeptide repeat protein Ubiquitously transcribed TPR protein on the X chromosome Kdm6a Utx Histone demethylase UTX [histone H3]-trimethyl-L-lysine(27) demethylase 6A protein protein mouse Mus musculus Mouse MKSCGVSLATAAAAAAAAAFGDEEKKMAAGKASGESEEASPSLTAEEREALGGLDSRLFGFVRFHEDGARMKALLGKAVRCYESLILKAEGKVESDFFCQLGHFNLLLEDYPKALSAYQRYYSLQSDYWKNAAFLYGLGLVYFHYNAFQWAIKAFQEVLYVDPSFCRAKEIHLRLGLMFKVNTDYESSLKHFQLALVDCNPCTLSNAEIQFHIAHLYETQRKYHSAKEAYEQLLQTENLSAQVKATILQQLGWMHHTVDLLGDKATKESYAIQYLQKSLEADPNSGQSWYFLGRCYSSIGKVQDAFISYRQSIDKSEASADTWCSIGVLYQQQNQPMDALQAYICAVQLDHGHAAAWMDLGTLYESCNQPQDAIKCYLNATRSKNCSNTSGLAARIKYLQAQLCNLPQGSLQNKTKLLPSIEEAWSLPIPAELTSRQGAMNTAQQNTSDNWSGGNAPPPVEQQTHSWCLTPQKLQHLEQLRANRNNLNPAQKLMLEQLESQFVLMQQHQMRQTGVAQVRPTGILNGPTVDSSLPTNSVSGQQPQLPLTRMPSVSQPGVHTACPRQTLANGPFSAGHVPCSTSRTLGSTDTVLIGNNHVTGSGSNGNVPYLQRNAPTLPHNRTNLTSSTEEPWKNQLSNSTQGLHKGPSSHLAGPNGERPLSSTGPSQHLQAAGSGIQNQNGHPTLPSNSVTQGAALNHLSSHTATSGGQQGITLTKESKPSGNTLTVPETSRQTGETPNSTASVEGLPNHVHQVMADAVCSPSHGDSKSPGLLSSDNPQLSALLMGKANNNVGPGTCDKVNNIHPTVHTKTDNSVASSPSSAISTATPSPKSTEQTTTNSVTSLNSPHSGLHTINGEGMEESQSPIKTDLLLVSHRPSPQIIPSMSVSIYPSSAEVLKACRNLGKNGLSNSSILLDKCPPPRPPSSPYPPLPKDKLNPPTPSIYLENKRDAFFPPLHQFCTNPNNPVTVIRGLAGALKLDLGLFSTKTLVEANNEHMVEVRTQLLQPADENWDPTGTKKIWHCESNRSHTTIAKYAQYQASSFQESLREENEKRSHHKDHSDSESTSSDNSGKRRKGPFKTIKFGTNIDLSDDKKWKLQLHELTKLPAFVRVVSAGNLLSHVGHTILGMNTVQLYMKVPGSRTPGHQENNNFCSVNINIGPGDCEWFVVPEGYWGVLNDFCEKNNLNFLMGSWWPNLEDLYEANVPVYRFIQRPGDLVWINAGTVHWVQAIGWCNNIAWNVGPLTACQYKLAVERYEWNKLQNVKSIVPMVHLSWNMARNIKVSDPKLFEMIKYCLLRTLKQCQTLREALIAAGKEIIWHGRTKEEPAHYCSICEVEVFDLLFVTNESNSRKTYIVHCQDCARKTSGNLENFVVLEQYKMEDLMQVYDQFTLAPPLPSASS 293DA417F49EECFF hxc11_amplicon_2_mouse Mouse hxc11_gene_amplicon_2 (-2317) - (-2009) ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse AGCTGCCTGCCTCACTTTTATGGTGGCCCATGAATAAACTTTGGTGGTCAAATTCAAGTGCTTAGGCCCACAGCTGTCTTCTCACAGGAAGCAGATACCCCCCCACCCCCACCTCTCTCCAAGGCTGTGCAAAACAGGACTTAGGGGATTGATCCCCACCCTGCCCTGAAGAGCAAGAAGAAAAAGTAAGAAAAACCTAGTGGGAAAACGGGGGAAAGCAGGAGCCAAGACCACCCTCATCTCTGCAAGAGATGGGGTACCTCTGGCCTTCTTCTTGCTGGCTTCTATGACTGTTTGGGGAGCATTTTG chr15:102952110-102952418 suz12_mouse Polycomb protein Suz12 Suz12 D11Ertd530e Kiaa0160 Suppressor of zeste 12 protein homolog protein protein mouse Mus musculus Mouse MAPQKHGGGGGGGSGPSAGSGGGGFGGSAAAVAAAASGGKSGGGGCGGGGSYSASSSSAAAAAAAAGAAVLPVKKPKMEHVQADHELFLQAFEKPTQIYRFLRTRNLIAPIFLHRTLTYMSHRNSRTSIKRKTFKVDDMLSKVEKMKGEQESHSLSAHLQLTFTGFFHKNDKPSQNSENEQNSVTLEVLLVKVCHKKRKDVSCPIRQVPTGKKQVPLNPDLNQTKPGNFPSLAVSSNEFEPSNSHMVKSYSLLFRVTRPGRREFNGMINGETNENIDVSEELPARRKRNREDGEKTFVAQMTVFDKNRRLQLLDGEYEVAMQEMEECPISKKRATWETILDGKRLPPFETFSQGPTLQFTLRWTGETNDKSTAPVAKPLATRNSESLHQENKPGSVKPAQTIAVKETLTTELQTRKEKDNSNESRQKLRIFYQFLYNNNTRQQTEARDDLHCPWCTLNCRKLYSLLKHLKLCHSRFIFNYVYHPKGARIDVSINECYDGSYAGNPQDIHRQPGFAFSRNGPVKRTPITHILVCRPKRTKASMSEFLESEDGEVEQQRTYSSGHNRLYFHSDTCLPLRPQEMEVDSEDEKDPEWLREKTITQIEEFSDVNEGEKEVMKLWNLHVMKHGFIADNQMNHACMLFVENYGQKIIKKNLCRNFMLHLVSMHDFNLISIMSIDKAVTKLREMQQKLEKGESATPSNEEIAEEQNGTANGFSETNSKEKALETDGVSGVPKQSKKQKL DIP protein Q80U70 original sequence version: 62 DIP protein Q80U70 original sequence version: 85 DIP protein Q80U70 original sequence version: 84 4A6B6E52D24FAEF2 hxc11_amplicon_5_mouse Mouse hxc11_gene_amplicon_5 (-1009) - (-721) ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse TCCAAATGTAGTTCCCTTAGCATACATCCTGCCTGGACCTTATTGCCAGCCTTCTTTTCAGCCTATTAGCTGAAGCTGAGCTCCCAACCCGAAGGGCCCCAGATAGAGAAGATAGATGACTCTCACTCTAAATCTTTTTCTTTGGGGTTTGGGATTTTAAAATCCACAGTGAATGTAGCTTTCTGCACATTGATTGACAATAAAGGCAGGCATGAAATATTCACCCAGGGCCACTCTCTCATACTAAATATTTAACACAACATTAGAGAAGGTTTTTCCCAGACTTCGC chr15:102953418-102953706 hxc11_mouse_gene Homeobox protein Hox-C11 Hoxc11 Hox-3.7 Hoxc-11 Homeobox protein Hox-3.7 gene gene mouse Mus musculus Mouse hxc12_mouse_gene Homeobox protein Hox-C12 Hoxc12 Hox-3.8 Hoxc-12 Homeobox protein Hox-3.8 gene gene mouse Mus musculus Mouse akt1_mouse RAC-alpha serine/threonine-protein kinase Akt1 Akt Rac RAC-PK-alpha AKT1 kinase Proto-oncogene c-Akt Protein kinase B Thymoma viral proto-oncogene Protein kinase B alpha protein protein mouse Mus musculus Mouse MNDVAIVKEGWLHKRGEYIKTWRPRYFLLKNDGTFIGYKERPQDVDQRESPLNNFSVAQCQLMKTERPRPNTFIIRCLQWTTVIERTFHVETPEEREEWATAIQTVADGLKRQEEETMDFRSGSPSDNSGAEEMEVSLAKPKHRVTMNEFEYLKLLGKGTFGKVILVKEKATGRYYAMKILKKEVIVAKDEVAHTLTENRVLQNSRHPFLTALKYSFQTHDRLCFVMEYANGGELFFHLSRERVFSEDRARFYGAEIVSALDYLHSEKNVVYRDLKLENLMLDKDGHIKITDFGLCKEGIKDGATMKTFCGTPEYLAPEVLEDNDYGRAVDWWGLGVVMYEMMCGRLPFYNQDHEKLFELILMEEIRFPRTLGPEAKSLLSGLLKKDPTQRLGGGSEDAKEIMQHRFFANIVWQDVYEKKLSPPFKPQVTSETDTRYFDEEFTAQMITITPPDQDDSMECVDSERRPHFPQFSYSASGTA DIP protein P31750 original sequence version: 125 DIP protein P31750 original sequence version: 168 DIP protein P31750 original sequence version: 88 98DF28E5EFE03730 hxc12_amplicon_5 _mouse(-462)-(-251) hxc12_amplicon_5 _mouse(-462)-(-251) ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse GCTCATCCGTCTCCTTAAACAGCCAGTAAACTTTATATGACACAATATCTAATAGTAATTTATTGGGGAGATATTGTAAATTCCAACGGTTTTAGTTAATAAAGGAGCTAATTAAAGAGGGACGGGCTGTGCTCGGCCAGCTGTTGGTGATAAGATAATACATCTGGGGAGGGGTGCAGGGTGCAGAGGTGTGTATGTGCGGATATTTTTG hdac6_mouse Histone deacetylase 6 Histone deacetylase mHDA2 Hdac6 Tubulin-lysine deacetylase HDAC6 protein protein mouse Mus musculus Mouse MTSTGQDSSTRQRKSRHNPQSPLQESSATLKRGGKKCAVPHSSPNLAEVKKKGKMKKLSQPAEEDLVVGLQGLDLNPETRVPVGTGLVFDEQLNDFHCLWDDSFPESPERLHAIREQLILEGLLGRCVSFQARFAEKEELMLVHSLEYIDLMETTQYMNEGELRVLAETYDSVYLHPNSYSCACLATGSVLRLVDALMGAEIRNGMAVIRPPGHHAQHNLMDGYCMFNHLAVAARYAQKKHRIQRVLIVDWDVHHGQGTQFIFDQDPSVLYFSIHRYEHGRFWPHLKASNWSTIGFGQGQGYTINVPWNQTGMRDADYIAAFLHILLPVASEFQPQLVLVAAGFDALHGDPKGEMAATPAGFAHLTHLLMGLAGGKLILSLEGGYNLRALAKGVSASLHTLLGDPCPMLESCVVPCASAQTSIYCTLEALEPFWEVLERSVETQEEDEVEEAVLEEEEEEGGWEATALPMDTWPLLQNRTGLVYDEKMMSHCNLWDNHHPETPQRILRIMCHLEEVGLAARCLILPARPALDSELLTCHSAEYVEHLRTTEKMKTRDLHREGANFDSIYICPSTFACAKLATGAACRLVEAVLSGEVLNGIAVVRPPGHHAEPNAACGFCFFNSVAVAARHAQIIAGRALRILIVDWDVHHGNGTQHIFEDDPSVLYVSLHRYDRGTFFPMGDEGASSQVGRDAGIGFTVNVPWNGPRMGDADYLAAWHRLVLPIAYEFNPELVLISAGFDAAQGDPLGGCQVTPEGYAHLTHLLMGLAGGRIILILEGGYNLASISESMAACTHSLLGDPPPQLTLLRPPQSGALVSISEVIQVHRKYWRSLRLMKMEDKEECSSSRLVIKKLPPTASPVSAKEMTTPKGKVPEESVRKTIAALPGKESTLGQAKSKMAKAVLAQGQSSEQAAKGTTLDLATSKETVGGATTDLWASAAAPENFPNQTTSVEALGETEPTPPASHTNKQTTGASPLQGVTAQQSLQLGVLSTLELSREAEEAHDSEEGLLGEAAGGQDMNSLMLTQGFGDFNTQDVFYAVTPLSWCPHLMAVCPIPAAGLDVSQPCKTCGTVQENWVCLTCYQVYCSRYVNAHMVCHHEASEHPLVLSCVDLSTWCYVCQAYVHHEDLQDVKNAAHQNKFGEDMPHSH DIP protein Q9Z2V5 original sequence version: 131 D5F73BA3F79AF520 hxc12_amplicon_4 (-798)-(-495) mouse hxc12_gene_amplicon_4 (-798)-(-495) ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse CAGTTCAAGCCACCCCTAGATTTTCAAGAGCAGGAAAATAGGTCCGCACCAAACTCAGCACCTTCATTTGCTCTTCTCTCTGCCTTCGGTTCTTCCTCTACTGATGGAACCTTAGTGGAGGCTAAGGTTAGTTAGGGGTACAGAAGAGATAGAATGATCAATCCCCCTCTACACCTTTCTCGAGTGAAAGAACCTCAAGTATCTTTTCATACCCCTAGAAGAAAATGCAATGGAGACAACGCAGCAGCGCAGCGCTGGCAGGGCTGAGAGATAGCTGCAGGAAAACCTGTTCTCACCCCCACTT hxc11_amplicon_1_mouse Mouse hxc11_gene_amplicon_1 (-11500) - (-11255) ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse CGGTGTGCGTCTGTGAACGCGGAAGGCGGTGCGGAGCCTGAGTCTGATCACCCACCCGCCGGCCGGCCGCAGCCCCGCACACATTTCGTCTCGGTTTAGAGAGGACGGACGCCTCTTCTTGGCAGCGAACCTCCGAACAGTTACCGATTTTCAGCGCAAAGGTCTATGGCCCGTGCCTCTCCCGCTAGATCGCAGCCTTTGGGGGCGGTTGAGCGCGGTTAGCCGGCTCTGGTGGTTGCTTCTCCC 102942927-102943172 hxc11_amplicon_6_mouse Mouse hxc11_gene_amplicon_6 (-697) - (-405) ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse GCACTGCTCACCACTGGTTTATGACTAATAGGAGTCCCTAGCCAGCGGCAGCACAGCAAGCTAGACAAAGTTGGGACACTGGCTCATAGCTGGGCTGCCTCACCTTTGGGAAACTTCAGATACTCTTCCTGGGAGCCTGTCCTATAAGGGAGCGCACCTTATTCTGGTCAGGAAAGTAATATAAAGGACTTCTTATGAACAAGCTCTGATTCTTCAGGTAGAGGGTTAAGAGTCCCTGAAACTTGTTGGGAAGCATCCAATATTTCCGGGGAAATCAGGCAGGAAAAGACCCT chr15:102953730-102954022 hxc11_amplicon_7_mouse Mouse hxc11_gene_amplicon_7 (-387) -(-145) ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse CCCCAGCTTGTCATAAGGAGGGGACCAAGACCCCGAAACGGAAAACCCTTCTCCTTCCCCCAATCCTAGGGGGGAAAAGAACAGCAGTTAAAAAAAAATACAATTACCCCCTCCCAGCCACCGCCCCCGCCCATCCCACCGCCCACCCCACCCCAACCCTCTCTCTCTCTCCTCCTTTTCTCGCTCTGTGGAATGGAGAGGAGGGGAGTGACGAGAGAAAAACGAATACAAATCTGCAATTGA chr15:102954040-102954282 kdm6b_mouse Lysine-specific demethylase 6B JmjC domain-containing protein 3 Jumonji domain-containing protein 3 Kdm6b Kiaa0346 Jmjd3 [histone H3]-trimethyl-L-lysine(27) demethylase 6B protein protein mouse Mus musculus Mouse MHRAVDPPGARSAREAFALGGLSCAGAWSSCPPHPPPRSSWLPGGRCSASVGQPPLSAPLPPSHGSSSGHPNKPYYAPGTPTPRPLHGKLESLHGCVQALLREPAQPGLWEQLGQLYESEHDSEEAVCCYHRALRYGGSFAELGPRIGRLQQAQLWNFHAGSCQHRAKVLPPLEQVWNLLHLEHKRNYGAKRGGPPVKRSAEPPVVQPMPPAALSGPSGEEGLSPGGKRRRGCSSEQAGLPPGLPLPPPPPPPPPPPPPPPPPPPPLPGLAISPPFQLTKPGLWNTLHGDAWGPERKGSAPPERQEQRHSMPHSYPYPAPAYSAHPPSHRLVPNTPLGPGPRPPGAESHGCLPATRPPGSDLRESRVQRSRMDSSVSPAASTACVPYAPSRPPGLPGTSSSSSSSSSSNNTGLRGVEPSPGIPGADHYQNPALEISPHQARLGPSAHSSRKPFLTAPAATPHLSLPPGTPSSPPPPCPRLLRPPPPPAWMKGSACRAAREDGEILGELFFGAEGPPRPPPPPLPHRDGFLGPPNPRFSVGTQDSHNPPIPPTTTSSSSSSNSHSSSPTGPVPFPPPSYLARSIDPLPRPSSPTLSPQDPPLPPLTLALPPAPPSSCHQNTSGSFRRSESPRPRVSFPKTPEVGQGPPPGPVSKAPQPVPPGVGELPARGPRLFDFPPTPLEDQFEEPAEFKILPDGLANIMKMLDESIRKEEEQQQQQEAGVAPPPPLKEPFASLQPPFPSDTAPATTTAAPTTATTTTTTTTTTTQEEEKKPPPALPPPPPLAKFPPPPQPQPPPPPPASPASLLKSLASVLEGQKYCYRGTGAAVSTRPGSVPATQYSPSPASGATAPPPTSVAPSAQGSPKPSVSSSSQFSTSGGPWAREHRAGEEPAPGPVTPAQLPPPLPLPPARSESEVLEEISRACETLVERVGRSAINPVDTADPVDSGTEPQPPPAQAKEESGGVAVAAAGPGSGKRRQKEHRRHRRACRDSVGRRPREGRAKAKAKAPKEKSRRVLGNLDLQSEEIQGREKARPDVGGVSKVKTPTAPAPPPAPAPAAQPTPPSAPVPGKKTREEAPGPPGVSRADMLKLRSLSEGPPKELKIRLIKVESGDKETFIASEVEERRLRMADLTISHCAADVMRASKNAKVKGKFRESYLSPAQSVKPKINTEEKLPREKLNPPTPSIYLESKRDAFSPVLLQFCTDPRNPITVIRGLAGSLRLNLGLFSTKTLVEASGEHTVEVRTQVQQPSDENWDLTGTRQIWPCESSRSHTTIAKYAQYQASSFQESLQEERESEDEESEEPDSTTGTSPSSAPDPKNHHIIKFGTNIDLSDAKRWKPQLQELLKLPAFMRVTSTGNMLSHVGHTILGMNTVQLYMKVPGSRTPGHQENNNFCSVNINIGPGDCEWFAVHEHYWETISAFCDRHGVDYLTGSWWPILDDLYASNIPVYRFVQRPGDLVWINAGTVHWVQATGWCNNIAWNVGPLTAYQYQLALERYEWNEVKNVKSIVPMIHVSWNVARTVKISDPDLFKMIKFCLLQSMKHCQVQRESLVRAGKKIAYQGRVKDEPAYYCNECDVEVFNILFVTSENGSRNTYLVHCEGCARRRSAGLQGVVVLEQYRTEELAQAYDAFTLAPASTSR DIP protein Q5NCY0 original sequence version: 27 6CBE3620998427EA hxc12_amplicon_6_mouse mouse_hxc12_gene_amplicon_6 (-180)- (+84) ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse CCCGTCTGCGTTAAGGTTTTATATGACTTTTTAAAAACCAGAATCCTACGAATAAATCTGTTCCTGCCTTTCGCTCCCCCATCTCCACCCAGGATTGGGGAAGGGGGAAGTAGAGTTGGTGCGGGGAATGTGGGTGGGGGGTTCGGTTGTCCCCACCCCTCCCCCTGGCGGTAGCGCCCACGTGAGTAGAGCGGCCAATGGGTGGCTGGTGCAGGTTTAACTATGTTTAATGTCAGATAGCAATAAAGTAGAAGCAGCCGGTCG ezh2_mouse Histone-lysine N-methyltransferase EZH2 Ezh2 Enx1h Enhancer of zeste homolog 2 ENX-1 protein protein mouse Mus musculus Mouse MGQTGKKSEKGPVCWRKRVKSEYMRLRQLKRFRRADEVKTMFSSNRQKILERTETLNQEWKQRRIQPVHIMTSVSSLRGTRECSVTSDLDFPAQVIPLKTLNAVASVPIMYSWSPLQQNFMVEDETVLHNIPYMGDEVLDQDGTFIEELIKNYDGKVHGDRECGFINDEIFVELVNALGQYNDDDDDDDGDDPDEREEKQKDLEDNRDDKETCPPRKFPADKIFEAISSMFPDKGTAEELKEKYKELTEQQLPGALPPECTPNIDGPNAKSVQREQSLHSFHTLFCRRCFKYDCFLHPFHATPNTYKRKNTETALDNKPCGPQCYQHLEGAKEFAAALTAERIKTPPKRPGGRRRGRLPNNSSRPSTPTISVLESKDTDSDREAGTETGGENNDKEEEEKKDETSSSSEANSRCQTPIKMKPNIEPPENVEWSGAEASMFRVLIGTYYDNFCAIARLIGTKTCRQVYEFRVKESSIIAPVPTEDVDTPPRKKKRKHRLWAAHCRKIQLKKDGSSNHVYNYQPCDHPRQPCDSSCPCVIAQNFCEKFCQCSSECQNRFPGCRCKAQCNTKQCPCYLAVRECDPDLCLTCGAADHWDSKNVSCKNCSIQRGSKKHLLLAPSDVAGWGIFIKDPVQKNEFISEYCGEIISQDEADRRGKVYDKYMCSFLFNLNNDFVVDATRKGNKIRFANHSVNPNCYAKVMMVNGDHRIGIFAKRAIQTGEELFFDYRYSQADALKYVGIEREMEIP 7442C751E13EA24B hxc11_amplicon_3_mouse Mouse hxc11_gene_amplicon_3 (-1755) - (-1460) ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse CAAACATAGGGAAGCACTGGAAGTCTCTTCTACAATATTGGAGACATCCCCACTCACCCACCCACACAGAGAAGGTGACTATGGTGGAGGCAGATTTCACCGAAGTATTGTTGTAAAGTCTGAGTAAATGTGGGCAGGTAGAAAAGTTGAGGAAAAATGGATTTGGGAAGATATATTTGGAAATAAGCTAGCCATTTCTGTCTTTCCTGTCTGACTGGGGCTTTCAGTGATTCATCCTTCAACAAAGAAAATCAAATTAAATACACTTTAAAGCGGGAAAACCAATCTGAAGGCGG chr15:102952672-102952967 hxc11_amplicon_4_mouse Mouse hxc11_gene_amplicon_4 (-1344) - (-1029) ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse CTGCTGCTTTCTGTTTGTGCCAGTTGTTTGGGCACCATGGATCCAGCCCAGAACATTTCCATAAAGTTATATTCAGATGCCCAGATGTATGTTGTAATAGCCAAAGGGACTGGAGGTTTAAGGAGTCATTGAGTATTCCCCTATGGACACAGCGGTCCAGCAAGGAGGGTTTATAGACTTGGAGAAGGGCAGGGTTGGACTGAGATGTAGAGAAGAAATAGGAGTGAAAGAGGCTGGGGACTTCAGGCCCTACCCTGCCTACTTTTTGATTGGTATTAGAGATAGACACCTCTACCCACCTAAGCTCCCCAAATCA chr15:102953083-102953398 hxc12_amplicon_2_mouse Mouse hxc12 gene amplicon 2 (-1862) - (1577) ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse GGCACTGTAGGGTCTTCTGGTTCTGAGTGAAGGTTGACTGCAGAGGCTGGCGTCCCACGGACAAGACCTCCGAGGTTCCAGAGTGGGTCTGGAGCTGGGCGGGCTCCTGGAGGCGGGTGGGACCAAGCGGGCTGCCAGGAAGGCTCGAGCTGAGGAAGGAGAACCGGCCAAGCGGGGCAAGGGGCGGGCGCCAAGCTGCGGGCTGCTAGCTGCGCGGGGCAGGGCGGCGCCCGCGGGGACACATTTCTGTCGGAATGAGCAGCTATGGTTTGGGATATGAATTCGC chr15:102934895-102935180 hxc12_amplicon_3_mouse Mouse hxc12 gene amplicon 3 (-1101)-(-800) ds dna double stranded deoxyribonucleic acid ds DNA ds dna mouse Mus musculus Mouse AACAGCCAGTGCTAGGTTCCCATCCTTCTCTAGAAGAAGCATCATAAATAAAAATTTGAGTTCTCAACAGGATACTTCTCCGGATTTTCCCCTCACTCTTGTCCCACCTCAGAAGGCAACTCACCCCTGGCCGCTGCTCCATACTGGCCCCACAGTCAGCCTGCAGGTTGTAGGGTAATCTCCTTTGCTGTAGAATATGTAATCATTTGGGCCAGCCAGTTTCTGCTGGGGCTGACAGCCTCCTGTCATAAAGATGAGGAGATTCTTAGAAGCTCCCAGTACCTAGAAGTCACAGCCGAAAA hdac6-hoxc12-1 2 9 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level amplicon_7 (+111)-(+325) sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chr15:102936867-102936886 TCTCCTGAATCCTGGGTTTG amplicon_8 (+357) -(+659) sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain CGTGGAGGATAGCAAGGGTTA chr15:102937113-102937415 amplicon_9 (+711)-(+1030) sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chr15:102937113-102937415 12 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Figure 3E Much reduced binding was seen in Akt1 −/− MEFs. I have added Primers from Table S3 Amplicon 3-9 inc. as these cover regions of the Gene -1000 bps to +1000bps which appears to be regions binding from fig 3E. akt1-hdac6-1 1 12 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Figure 3F akt1-hdac6-2 1 12 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Figure 3F-RHS This interaction was not observed in Akt1-null MEFs. akt1-hoxc12-1 2 8 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association Figure 3H no primers specified - antibody against HA- so one primer may be to tag. hdac6-hoxc12-2 2 9 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association Figure 3H Much reduced binding was seen in Akt1 −/− MEFs. no primers given - antibody against HA- so one primer may be to tag. akt1-hoxc12-2 2 9 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 19 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Figure 4B/D Reduced binding was seen in Akt1 −/− MEFs and cells treated with Akt1 siRNA. akt1-hoxc11-1 2 8 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 19 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Figure 4B/D Reduced binding was seen in Akt1 −/− MEFs and cells treated with Akt1 siRNA. ezh2-hoxc11-1 2 8 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 17 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Figure 4B/D Increased binding was seen in Akt1 −/− MEFs and cells treated with Akt1 siRNA. ezh2-hoxc12-2 2 9 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 17 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Figure 4B/D Increased binding was seen in Akt1 −/− MEFs and cells treated with Akt1 siRNA. hdac6-hoxc12-3 2 23 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102935656-102935957 12 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Figure 3E -Amplicon3 Much reduced binding was seen in Akt1 −/− MEFs. I have added Primers from Table S3 Amplicon 3-9 inc. as these cover regions of the Gene -1000 bps to +1000bps which appears to be regions binding from fig 3E. hdac6-hxc12_amplicon_3 (_1101)_(_800)-1 2 13 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102935959-102936262 12 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Figure 3E -Amplicon4 Much reduced binding was seen in Akt1 −/− MEFs. I have added Primers from Table S3 Amplicon 3-9 inc. as these cover regions of the Gene -1000 bps to +1000bps which appears to be regions binding from fig 3E. hdac6-hxc12_amplicon_4 (_798)_(_495)-1 2 11 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102936296-102936506 12 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Figure 3E -Amplicon5 Much reduced binding was seen in Akt1 −/− MEFs. I have added Primers from Table S3 Amplicon 3-9 inc. as these cover regions of the Gene -1000 bps to +1000bps which appears to be regions binding from fig 3E. hdac6-hxc12_amplicon_5 (_462)_(_251)-1 2 18 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102936577-102936840 12 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Figure 3E -Amplicon_6 Much reduced binding was seen in Akt1 −/− MEFs. I have added Primers from Table S3 Amplicon 3-9 inc. as these cover regions of the Gene -1000 bps to +1000bps which appears to be regions binding from fig 3E. hdac6-hoxc12-4 2 9 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level amplicon_9 (+711)-(+1030) sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chr15:102937113-102937415 CAGCCCACTTGTGATGCTTA 4 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Supp. Figure 3Aa Binding was seen in Akt1 +/+ and -/- MEFs. suz12-hxc12_amplicon_1_mouse-1 2 3 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102934526-102934825 6 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Supp. fig 3A-amp1 Increased binding at amplicon1 region was seen in Akt1 −/− MEFs. suz12-hxc12_amplicon_2_mouse-1 2 22 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102934526-102934825 6 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Supp. fig 3A-amp2 Weak binding was seen at amplicon 2 region in Akt1 −/− MEFs, but NO binding in Akt1 +/+ MEFS. hdac6-hxc12_amplicon_3_mouse-1 2 23 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102935656-102935957 6 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Suoo, figure 3 -Amplicon3 Reduced binding was seen in Akt1 −/− MEFs at amplicon 3. hdac6-hxc12_amplicon_4 (_798)_(_495)-2 2 13 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102935959-102936262 6 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Supp. Figure 3A -Amplicon4 Increased binding was seen in Akt1 −/− MEFs at amplicon 4. suz12-hxc12_amplicon_5 _mouse(_462)_(_251)-1 2 11 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102936296-102936506 6 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Supp. Figure 3A -Amplicon5 Binding was seen in Akt1 −/− and +/+ MEFs. hdac6-hxc12_amplicon_6_mouse-1 2 18 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102936577-102936840 6 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Supp. Figure 3A -Amplicon_6 Binding was seen in Akt1 −/− and +/+ MEFs. hdac6-hoxc12-5 2 9 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level amplicon_9 (+711)-(+1030)[711-1030] sufficient to bind sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain amplicon_7 (+111)-(+325) sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chr15:102936867-102936886 TCTCCTGAATCCTGGGTTTG amplicon_8 (+357) -(+659) sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain CGTGGAGGATAGCAAGGGTTA chr15:102937113-102937415 6 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Supp. Figure 3A Binding was seen in Akt1 −/− and +/+ MEFs. suz12-hxc11_amplicon_1_mouse-1 2 14 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102934526-102934825 6 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Supp. fig 3B-amp1 Increased binding at amplicon1 region was seen in Akt1 −/− MEFs. suz12-hxc12_amplicon_1_mouse-2 2 3 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102934526-102934825 4 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Supp. fig 3Aa-amp1 Increased binding at amplicon1 region was seen in Akt1 −/− MEFs. kdm6a-hxc12_amplicon_4 (_798)_(_495)-1 2 4 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level 13 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102935959-102936262 physical association physical association Supp. Figure 3Aa-Amplicon4 Increased binding was seen in Akt1 −/− MEFs at amplicon 4;only very weak binding for +/+ MEFs. suz12-hxc12_amplicon_5 _mouse(_462)_(_251)-2 2 11 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102936296-102936506 4 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Supp. Figure 3Aa -Amplicon5 Binding was increased in Akt1 −/− MEFs. kdm6a-hxc12_amplicon_6_mouse-1 2 18 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102936577-102936840 4 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Supp. Figure 3Aa -Amplicon_6 Binding was seen in Akt1 −/− and +/+ MEFs. kdm6a-hxc11_amplicon_1_mouse-1 2 14 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102934526-102934825 4 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Supp. fig 3Bb-amp1 Binding at amplicon1 region was seen in Akt1 −/− and +/+ MEFs. suz12-hoxc11-1 2 8 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level amplicon_9 (+557) - (847) sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain GCTTCTTCGACAACGCCTAC 15:102954983-102955273 amplicon_10 (+1130) - (+1432) sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain TAAGAAAGGATGGGGAGTCG chr15:102955556-102955858 amplicon_8 (+83) - (+334) sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain CCCCAGCTTGTCATAAGGAG chr15:102954040-102954282 amplicon_11 (+1181) - (+2184) sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain AGCGGATACGGAAGAGGAG chr15:102956307-102956610 6 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed physical association physical association Supp. Figure 3B suz12-hxc11_amplicon_2_mouse-1 2 5 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102934526-102934825 6 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Supp. fig 3B-amp2 Increased binding at amplicon 2 region was seen in Akt1 −/− MEFs. kdm6a-hxc11_amplicon_2_mouse-1 2 5 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102934526-102934825 4 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Supp. fig 3Bb-amp2 Increased binding at amplicon 2 region was seen in Akt1 −/− MEFs. kdm6a-hxc11_amplicon_3_mouse-1 2 20 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102934526-102934825 4 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Supp. fig 3Bb-amp3 Binding at amplicon 3 region was seen in Akt1 −/− and +/+ MEFs. kdm6a-hxc11_amplicon_3_mouse-2 2 20 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102934526-102934825 6 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Supp. fig 3B-amp3 Increased binding was seen at amplicon 3 region in Akt1 −/− MEFs. suz12-hxc11_amplicon_3_mouse-1 2 21 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102934526-102934825 6 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Supp. fig 3B-amp4 Weak binding was seen at amplicon 4 region in Akt1 −/− and +/+ MEFs. suz12-hxc11_amplicon_5_mouse-1 2 7 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102934526-102934825 6 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Supp. fig 3B-amp5 Stong binding was seen at amplicon 5 region in Akt1 −/− MEFs and very weak/ no binding for +/+ MEFs. suz12-hxc11_amplicon_6_mouse-1 2 15 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102934526-102934825 6 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Supp. fig 3B-amp6 Stong binding was seen at amplicon 6 region in Akt1 −/− MEFs and +/+ MEFs. suz12-hxc11_amplicon_6_mouse-2 2 15 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102934526-102934825 4 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Supp. fig 3Bb-amp6 Stong binding was seen at amplicon 6 region in Akt1 −/− MEFs and +/+ MEFs. suz12-hxc11_amplicon_7_mouse-1 2 16 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level chr15:102934526-102934825 6 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Supp. fig 3B-amp7 Weak binding was seen at amplicon 7 region in Akt1 −/− MEFs and +/+ MEFs. suz12-hoxc11-2 2 8 unspecified role unspecified role prey prey physiological level physiological level endogenous level endogenous endogenous endogenous level amplicon_9 (+557) - (847) sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain GCTTCTTCGACAACGCCTAC 15:102954983-102955273 amplicon_8 (+83) - (+334) sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain CCCCAGCTTGTCATAAGGAG chr15:102954040-102954282 amplicon_11 (+1181) - (+2184) sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain AGCGGATACGGAAGAGGAG chr15:102956307-102956610 4 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed physical association physical association Supp. Figure 3Bb Stronger binding was seen at amplicons 8,9 and 11 in -/- MEFS than +/+ MEFs.