IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Suppressed NFAT-dependent VEGFR1 expression and constitutive VEGFR2 signaling in infantile hemangioma. Suppressed NFAT-dependent VEGFR1 expression and constitutive VEGFR2 signaling in infantile hemangioma. Nature medicine 2008 imex curation Jinnin M., Medici D., Park L., Limaye N., Liu Y., Boscolo E., Bischoff J., Vikkula M., Boye E., Olsen BR. bjorn_olsen@hms.harvard.edu,eileen_boye@hms.harvard.edu 25-Jul-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-endothelium Homo sapiens endothelail cells/endothelium endothelium Endothelial cells [endothelium] anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Jinnin M., Medici D., Park L., Limaye N., Liu Y., Boscolo E., Bischoff J., Vikkula M., Boye E., Olsen BR. HDMEC (human dermal microvascular endothelial cells), HUVEC (Human umbilical vein endothelial cells) and hemEC (hemangioma endothelial cells) cells were used. bjorn_olsen@hms.harvard.edu,eileen_boye@hms.harvard.edu Accepted 2019-MAY-13 AT 12:02 BST AT 12:02 BST by PPORRAS Nature medicine 2008 Only protein-protein interactions imex curation imex curation Suppressed NFAT-dependent VEGFR1 expression and constitutive VEGFR2 signaling in infantile hemangioma. Suppressed NFAT-dependent VEGFR1 expression and constitutive VEGFR2 signaling in infantile hemangioma. Nature medicine 2008 imex curation Jinnin M., Medici D., Park L., Limaye N., Liu Y., Boscolo E., Bischoff J., Vikkula M., Boye E., Olsen BR. bjorn_olsen@hms.harvard.edu,eileen_boye@hms.harvard.edu 25-Jul-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-dermal_microvascular Human dermal microvascular endothelium cells (HDMVEC) dermal-microvascular_endothelium dermal microvascular endothelium ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Jinnin M., Medici D., Park L., Limaye N., Liu Y., Boscolo E., Bischoff J., Vikkula M., Boye E., Olsen BR. bjorn_olsen@hms.harvard.edu,eileen_boye@hms.harvard.edu Accepted 2019-MAY-13 AT 12:02 BST AT 12:02 BST by PPORRAS Nature medicine 2008 Only protein-protein interactions imex curation imex curation Suppressed NFAT-dependent VEGFR1 expression and constitutive VEGFR2 signaling in infantile hemangioma. Suppressed NFAT-dependent VEGFR1 expression and constitutive VEGFR2 signaling in infantile hemangioma. Nature medicine 2008 imex curation Jinnin M., Medici D., Park L., Limaye N., Liu Y., Boscolo E., Bischoff J., Vikkula M., Boye E., Olsen BR. bjorn_olsen@hms.harvard.edu,eileen_boye@hms.harvard.edu 25-Jul-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-endothelium Homo sapiens endothelail cells/endothelium endothelium Endothelial cells [endothelium] ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Jinnin M., Medici D., Park L., Limaye N., Liu Y., Boscolo E., Bischoff J., Vikkula M., Boye E., Olsen BR. HDMEC (human dermal microvascular endothelial cells) and hemEC (hemangioma endothelial cells) cells were used. bjorn_olsen@hms.harvard.edu,eileen_boye@hms.harvard.edu Accepted 2019-MAY-13 AT 12:02 BST AT 12:02 BST by PPORRAS Nature medicine 2008 Only protein-protein interactions imex curation imex curation Suppressed NFAT-dependent VEGFR1 expression and constitutive VEGFR2 signaling in infantile hemangioma. Suppressed NFAT-dependent VEGFR1 expression and constitutive VEGFR2 signaling in infantile hemangioma. Nature medicine 2008 imex curation Jinnin M., Medici D., Park L., Limaye N., Liu Y., Boscolo E., Bischoff J., Vikkula M., Boye E., Olsen BR. bjorn_olsen@hms.harvard.edu,eileen_boye@hms.harvard.edu 25-Jul-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-293 ebna Homo sapiens 293 ebna 293 ebna anti bait coip anti bait coimmunoprecipitation anti bait coip anti tag western anti tag western blot anti tag western Jinnin M., Medici D., Park L., Limaye N., Liu Y., Boscolo E., Bischoff J., Vikkula M., Boye E., Olsen BR. bjorn_olsen@hms.harvard.edu,eileen_boye@hms.harvard.edu Accepted 2019-MAY-13 AT 12:02 BST AT 12:02 BST by PPORRAS Nature medicine 2008 Only protein-protein interactions imex curation imex curation nfac2_human Nuclear factor of activated T-cells, cytoplasmic 2 T-cell transcription factor NFAT1 NFAT pre-existing subunit NFATC2 NFAT1 NFATP protein protein human Homo sapiens Human MNAPERQPQPDGGDAPGHEPGGSPQDELDFSILFDYEYLNPNEEEPNAHKVASPPSGPAYPDDVLDYGLKPYSPLASLSGEPPGRFGEPDRVGPQKFLSAAKPAGASGLSPRIEITPSHELIQAVGPLRMRDAGLLVEQPPLAGVAASPRFTLPVPGFEGYREPLCLSPASSGSSASFISDTFSPYTSPCVSPNNGGPDDLCPQFQNIPAHYSPRTSPIMSPRTSLAEDSCLGRHSPVPRPASRSSSPGAKRRHSCAEALVALPPGASPQRSRSPSPQPSSHVAPQDHGSPAGYPPVAGSAVIMDALNSLATDSPCGIPPKMWKTSPDPSPVSAAPSKAGLPRHIYPAVEFLGPCEQGERRNSAPESILLVPPTWPKPLVPAIPICSIPVTASLPPLEWPLSSQSGSYELRIEVQPKPHHRAHYETEGSRGAVKAPTGGHPVVQLHGYMENKPLGLQIFIGTADERILKPHAFYQVHRITGKTVTTTSYEKIVGNTKVLEIPLEPKNNMRATIDCAGILKLRNADIELRKGETDIGRKNTRVRLVFRVHIPESSGRIVSLQTASNPIECSQRSAHELPMVERQDTDSCLVYGGQQMILTGQNFTSESKVVFTEKTTDGQQIWEMEATVDKDKSQPNMLFVEIPEYRNKHIRTPVKVNFYVINGKRKRSQPQHFTYHPVPAIKTEPTDEYDPTLICSPTHGGLGSQPYYPQHPMVAESPSCLVATMAPCQQFRTGLSSPDARYQQQNPAAVLYQRSKSLSPSLLGYQQPALMAAPLSLADAHRSVLVHAGSQGQSSALLHPSPTNQQASPVIHYSPTNQQLRCGSHQEFQHIMYCENFAPGTTRPGPPPVSQGQRLSPGSYPTVIQQQNATSQRAAKNGPPVSDQKEVLPAGVTIKQEQNLDQTYLDDVNEIIRKEFSGPPARNQT DIP protein Q13469 original sequence version: 99 DIP protein Q13469 original sequence version: 100 DIP protein Q13469 original sequence version: 167 8DAE86855CCB58D3 itb1_human Integrin beta-1 Fibronectin receptor subunit beta VLA-4 subunit beta ITGB1 FNRB MDF2 MSK12 Glycoprotein IIa protein protein human Homo sapiens Human MNLQPIFWIGLISSVCCVFAQTDENRCLKANAKSCGECIQAGPNCGWCTNSTFLQEGMPTSARCDDLEALKKKGCPPDDIENPRGSKDIKKNKNVTNRSKGTAEKLKPEDITQIQPQQLVLRLRSGEPQTFTLKFKRAEDYPIDLYYLMDLSYSMKDDLENVKSLGTDLMNEMRRITSDFRIGFGSFVEKTVMPYISTTPAKLRNPCTSEQNCTSPFSYKNVLSLTNKGEVFNELVGKQRISGNLDSPEGGFDAIMQVAVCGSLIGWRNVTRLLVFSTDAGFHFAGDGKLGGIVLPNDGQCHLENNMYTMSHYYDYPSIAHLVQKLSENNIQTIFAVTEEFQPVYKELKNLIPKSAVGTLSANSSNVIQLIIDAYNSLSSEVILENGKLSEGVTISYKSYCKNGVNGTGENGRKCSNISIGDEVQFEISITSNKCPKKDSDSFKIRPLGFTEEVEVILQYICECECQSEGIPESPKCHEGNGTFECGACRCNEGRVGRHCECSTDEVNSEDMDAYCRKENSSEICSNNGECVCGQCVCRKRDNTNEIYSGKFCECDNFNCDRSNGLICGGNGVCKCRVCECNPNYTGSACDCSLDTSTCEASNGQICNGRGICECGVCKCTDPKFQGQTCEMCQTCLGVCAEHKECVQCRAFNKGEKKDTCTQECSYFNITKVESRDKLPQPVQPDPVSHCKEKDVDDCWFYFTYSVNGNNEVMVHVVENPECPTGPDIIPIVAGVVAGIVLIGLALLLIWKLLMIIHDRREFAKFEKEKMNAKWDTGENPIYKSAVTTVVNPKYEGK DIP protein P05556 original sequence version: 139 DIP protein P05556-1 original sequence version: 143 DIP protein P05556 original sequence version: 154 DIP protein P05556 original sequence version: 167 DE35979C1625578C human_ vegfr1_gene human vascular endothelial growth factor receptor 1 nucleic acid nucleic acid human Homo sapiens Human vgfr2_human Vascular endothelial growth factor receptor 2 Kinase insert domain receptor Protein-tyrosine kinase receptor flk-1 KDR FLK1 Fetal liver kinase 1 VEGFR2 protein protein human Homo sapiens Human MQSKVLLAVALWLCVETRAASVGLPSVSLDLPRLSIQKDILTIKANTTLQITCRGQRDLDWLWPNNQSGSEQRVEVTECSDGLFCKTLTIPKVIGNDTGAYKCFYRETDLASVIYVYVQDYRSPFIASVSDQHGVVYITENKNKTVVIPCLGSISNLNVSLCARYPEKRFVPDGNRISWDSKKGFTIPSYMISYAGMVFCEAKINDESYQSIMYIVVVVGYRIYDVVLSPSHGIELSVGEKLVLNCTARTELNVGIDFNWEYPSSKHQHKKLVNRDLKTQSGSEMKKFLSTLTIDGVTRSDQGLYTCAASSGLMTKKNSTFVRVHEKPFVAFGSGMESLVEATVGERVRIPAKYLGYPPPEIKWYKNGIPLESNHTIKAGHVLTIMEVSERDTGNYTVILTNPISKEKQSHVVSLVVYVPPQIGEKSLISPVDSYQYGTTQTLTCTVYAIPPPHHIHWYWQLEEECANEPSQAVSVTNPYPCEEWRSVEDFQGGNKIEVNKNQFALIEGKNKTVSTLVIQAANVSALYKCEAVNKVGRGERVISFHVTRGPEITLQPDMQPTEQESVSLWCTADRSTFENLTWYKLGPQPLPIHVGELPTPVCKNLDTLWKLNATMFSNSTNDILIMELKNASLQDQGDYVCLAQDRKTKKRHCVVRQLTVLERVAPTITGNLENQTTSIGESIEVSCTASGNPPPQIMWFKDNETLVEDSGIVLKDGNRNLTIRRVRKEDEGLYTCQACSVLGCAKVEAFFIIEGAQEKTNLEIIILVGTAVIAMFFWLLLVIILRTVKRANGGELKTGYLSIVMDPDELPLDEHCERLPYDASKWEFPRDRLKLGKPLGRGAFGQVIEADAFGIDKTATCRTVAVKMLKEGATHSEHRALMSELKILIHIGHHLNVVNLLGACTKPGGPLMVIVEFCKFGNLSTYLRSKRNEFVPYKTKGARFRQGKDYVGAIPVDLKRRLDSITSSQSSASSGFVEEKSLSDVEEEEAPEDLYKDFLTLEHLICYSFQVAKGMEFLASRKCIHRDLAARNILLSEKNVVKICDFGLARDIYKDPDYVRKGDARLPLKWMAPETIFDRVYTIQSDVWSFGVLLWEIFSLGASPYPGVKIDEEFCRRLKEGTRMRAPDYTTPEMYQTMLDCWHGEPSQRPTFSELVEHLGNLLQANAQQDGKDYIVLPISETLSMEEDSGLSLPTSPVSCMEEEEVCDPKFHYDNTAGISQYLQNSKRKSRPVSVKTFEDIPLEEPEVKVIPDDNQTDSGMVLASEELKTLEDRTKLSPSFGGMVPSKSRESVASEGSNQTSGYQSGYHSDDTDTTVYSSEEAELLKLIEIGVQTGSTAQILQPDSGTTLSSPPV DIP protein P35968 original sequence version: 81 DIP protein P35968 original sequence version: 146 DIP protein P35968 original sequence version: 117 DIP protein P35968 original sequence version: 121 59E7C44B05CFEBB3 antr1_human Anthrax toxin receptor 1 ANTXR1 ATR TEM8 Tumor endothelial marker 8 protein protein human Homo sapiens Human MATAERRALGIGFQWLSLATLVLICAGQGGRREDGGPACYGGFDLYFILDKSGSVLHHWNEIYYFVEQLAHKFISPQLRMSFIVFSTRGTTLMKLTEDREQIRQGLEELQKVLPGGDTYMHEGFERASEQIYYENRQGYRTASVIIALTDGELHEDLFFYSEREANRSRDLGAIVYCVGVKDFNETQLARIADSKDHVFPVNDGFQALQGIIHSILKKSCIEILAAEPSTICAGESFQVVVRGNGFRHARNVDRVLCSFKINDSVTLNEKPFSVEDTYLLCPAPILKEVGMKAALQVSMNDGLSFISSSVIITTTHCSDGSILAIALLILFLLLALALLWWFWPLCCTVIIKEVPPPPAEESEEEDDDGLPKKKWPTVDASYYGGRGVGGIKRMEVRWGEKGSTEEGAKLEKAKNARVKMPEQEYEFPEPRNLNNNMRRPSSPRKWYSPIKGKLDALWVLLRKGYDRVSVMRPQPGDTGRCINFTRVKNNQPAKYPLNNAYHTSSPPPAPIYTPPPPAPHCPPPPPSAPTPPIPSPPSTLPPPPQAPPPNRAPPPSRPPPRPSV B118A00AD5DF2233 antxr1-itgb1-1 1 9 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 6 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 8 unspecified role unspecified role bait bait living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Figure 5a The interaction was detected in samples of 9 patients with hemangioma antxr1-itgb1-2 4 9 unspecified role unspecified role prey prey over-expressed over expressed level over-expressed living cell living cell region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined Q9H6X2:p.Ala326Thr mutation increasing strength mutation increasing interaction strength mutation increasing strength certain certain sequence position certain certain certain sequence position certain A T Tue Jun 30 17:30:01 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala326Thr' 6 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 8 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined P35968:p.Cys482Arg mutation increasing strength mutation increasing interaction strength mutation increasing strength certain certain sequence position certain certain certain sequence position certain C R Tue Jun 30 17:39:37 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Cys482Arg' association association Figure 5b antxr1-nfatc2-1 3 7 unspecified role unspecified role prey prey over-expressed over expressed level over-expressed living cell living cell promoter sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined Forward primer: CTGGGAGGAAGAAGAGGGTAGGTG Reverse primer: CGAGGGCGGGGGCGATTTAT 5 unspecified role unspecified role bait bait living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association Figure 5d Human TEM8 (UniProt: Q9H6X2) with p.Ala326Thr mutation significantly reduced the association of NFATc2 with VEGFR1 promoter human_ vegfr1_gene-nfatc2-1 2 5 unspecified role unspecified role bait bait living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 7 unspecified role unspecified role prey prey over-expressed over expressed level over-expressed living cell living cell promoter sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined Forward primer: CTGGGAGGAAGAAGAGGGTAGGTG Reverse primer: CGAGGGCGGGGGCGATTTAT physical association physical association Figure 5d Human TEM8 (UniProt: Q9H6X2) with p.Ala326Thr mutation significantly reduced the association of NFATc2 with VEGFR1 promoter