IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ ETS transcription factor ERG cooperates with histone demethylase KDM4A. ETS transcription factor ERG cooperates with histone demethylase KDM4A. Oncology reports 2016 imex curation Kim TD., Shin S., Janknecht R. ralf-janknecht@ouhsc.edu 27-Mar-2018: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Kim TD., Shin S., Janknecht R. It was observed that ERG alone did not bind to any of the ETS sites within the YAP1 promoter. However when anti-myc antibodies were used DNA binding was observed. origin species of ERG has been provided by authors ralf-janknecht@ouhsc.edu Accepted 2018-FEB-19 AT 10:35 GMT AT 10:35 GMT by MGT Oncology reports 2016 Only protein-protein interactions imex curation imex curation flag tag removed and my tag range put as ?-? since not specified. mutation added. probes modified as requested. competition binding with e74 and me74 added. binary pairs annotated as physical association and not as association ETS transcription factor ERG cooperates with histone demethylase KDM4A. ETS transcription factor ERG cooperates with histone demethylase KDM4A. Oncology reports 2016 imex curation Kim TD., Shin S., Janknecht R. ralf-janknecht@ouhsc.edu 27-Mar-2018: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro pull down pull down anti tag western anti tag western blot anti tag western Kim TD., Shin S., Janknecht R. origin species of ERG has been provided by authors ralf-janknecht@ouhsc.edu Accepted 2018-FEB-19 AT 10:35 GMT AT 10:35 GMT by MGT Oncology reports 2016 Only protein-protein interactions imex curation imex curation flag tag removed and my tag range put as ?-? since not specified. mutation added. probes modified as requested. competition binding with e74 and me74 added. binary pairs annotated as physical association and not as association ETS transcription factor ERG cooperates with histone demethylase KDM4A. ETS transcription factor ERG cooperates with histone demethylase KDM4A. Oncology reports 2016 imex curation Kim TD., Shin S., Janknecht R. ralf-janknecht@ouhsc.edu 27-Mar-2018: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. anti tag coip anti tag coimmunoprecipitation anti tag coip anti tag western anti tag western blot anti tag western Kim TD., Shin S., Janknecht R. origin species of ERG has been provided by authors ralf-janknecht@ouhsc.edu Accepted 2018-FEB-19 AT 10:35 GMT AT 10:35 GMT by MGT Oncology reports 2016 Only protein-protein interactions imex curation imex curation flag tag removed and my tag range put as ?-? since not specified. mutation added. probes modified as requested. competition binding with e74 and me74 added. binary pairs annotated as physical association and not as association kdm4a_human Lysine-specific demethylase 4A KDM4A JMJD2 KIAA0677 Jumonji domain-containing protein 2A JHDM3A [histone H3]-trimethyl-L-lysine(36) demethylase 4A [histone H3]-trimethyl-L-lysine(9) demethylase 4A JMJD2A JmjC domain-containing histone demethylation protein 3A protein protein human Homo sapiens Human MASESETLNPSARIMTFYPTMEEFRNFSRYIAYIESQGAHRAGLAKVVPPKEWKPRASYDDIDDLVIPAPIQQLVTGQSGLFTQYNIQKKAMTVREFRKIANSDKYCTPRYSEFEELERKYWKNLTFNPPIYGADVNGTLYEKHVDEWNIGRLRTILDLVEKESGITIEGVNTPYLYFGMWKTSFAWHTEDMDLYSINYLHFGEPKSWYSVPPEHGKRLERLAKGFFPGSAQSCEAFLRHKMTLISPLMLKKYGIPFDKVTQEAGEFMITFPYGYHAGFNHGFNCAESTNFATRRWIEYGKQAVLCSCRKDMVKISMDVFVRKFQPERYKLWKAGKDNTVIDHTLPTPEAAEFLKESELPPRAGNEEECPEEDMEGVEDGEEGDLKTSLAKHRIGTKRHRVCLEIPQEVSQSELFPKEDLSSEQYEMTECPAALAPVRPTHSSVRQVEDGLTFPDYSDSTEVKFEELKNVKLEEEDEEEEQAAAALDLSVNPASVGGRLVFSGSKKKSSSSLGSGSSRDSISSDSETSEPLSCRAQGQTGVLTVHSYAKGDGRVTVGEPCTRKKGSAARSFSERELAEVADEYMFSLEENKKSKGRRQPLSKLPRHHPLVLQECVSDDETSEQLTPEEEAEETEAWAKPLSQLWQNRPPNFEAEKEFNETMAQQAPHCAVCMIFQTYHQVEFGGFNQNCGNASDLAPQKQRTKPLIPEMCFTSTGCSTDINLSTPYLEEDGTSILVSCKKCSVRVHASCYGVPPAKASEDWMCSRCSANALEEDCCLCSLRGGALQRANDDRWVHVSCAVAILEARFVNIAERSPVDVSKIPLPRFKLKCIFCKKRRKRTAGCCVQCSHGRCPTAFHVSCAQAAGVMMQPDDWPFVVFITCFRHKIPNLERAKGALQSITAGQKVISKHKNGRFYQCEVVRLTTETFYEVNFDDGSFSDNLYPEDIVSQDCLQFGPPAEGEVVQVRWTDGQVYGAKFVASHPIQMYQVEFEDGSQLVVKRDDVYTLDEELPKRVKSRLSVASDMRFNEIFTEKEVKQEKKRQRVINSRYREDYIEPALYRAIME 4A811BEECFEDC6B3 yap1_human_ets-site1/2 Human YAP1 gene promoter ETS site1/2 -387/-379 DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human AGCGGAGCGGAAGAACTTCCTGCAGCCA e74_dna-probe E74 DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid in vitro In vitro AGCTTCTCTAGCTGAATAACCGGAAGTAACTCATCG yap1_human_ets-site6/7_dna-probe Human YAP1 gene promoter ETS site6/7 DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human GCGCAGAGGAAGGAAGAGCCGAG erg_human Transcriptional regulator ERG ERG Transforming protein ERG protein protein human Homo sapiens Human MASTIKEALSVVSEDQSLFECAYGTPHLAKTEMTASSSSDYGQTSKMSPRVPQQDWLSQPPARVTIKMECNPSQVNGSRNSPDECSVAKGGKMVGSPDTVGMNYGSYMEEKHMPPPNMTTNERRVIVPADPTLWSTDHVRQWLEWAVKEYGLPDVNILLFQNIDGKELCKMTKDDFQRLTPSYNADILLSHLHYLRETPLPHLTSDDVDKALQNSPRLMHARNTGGAAFIFPNTSVYPEATQRITTRPDLPYEPPRRSAWTGHGHPTPQSKAAQPSPSTVPKTEDQRPQLDPYQILGPTSSRLANPGSGQIQLWQFLLELLSDSSNSSCITWEGTNGEFKMTDPDEVARRWGERKSKPNMNYDKLSRALRYYYDKNIMTKVHGKRYAYKFDFHGIAQALQPHPPESSLYKYPSDLPYMGSYHAHPQKMNFVAPHPPALPVTSSSFFAAPNPYWNSPTGGIYPNTRLPTSHMPSHLGTYY DIP protein P11308 original sequence version: 138 A5069C393E409483 yap1_human_ets_site1/2-erg-1 1 8 unspecified role unspecified role prey prey over-expressed over expressed level over-expressed cell lysate cell lysate c_terminus myc tag myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. 5 unspecified role unspecified role bait bait purified purified A11T mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain A T T18A mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain T A 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 2 C To determine whether ERG binds to both ETS sites 1 and 2, we mutated each one individually in the '1/2' oligonucleotide. Mutation of either ETS site 1 or 2 resulted in similarly reduced ERG binding (Fig. 2C), indicating that ERG can interact with ETS sites 1 and 2 with comparable affinity. Likewise, we observed that mutation of either ETS site 6 or 7 reduced ERG binding to the 32P-labeled '6/7' oligonucleotide (Fig. 2C). However, whereas mutation of ETS site 7 somewhat reduced DNA-binding, mutation of ETS site 6 completely abolished DNA-binding, suggesting that ERG binding to ETS site 7 is dependent on the integrity of ETS site 6. yap1_human_ets_site6/7_dna_probe-erg-1 1 8 unspecified role unspecified role prey prey over-expressed over expressed level over-expressed cell lysate cell lysate c_terminus myc tag myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. 7 unspecified role unspecified role bait bait purified purified 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined G8C mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain G C A15C mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain A C chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 2 C To determine whether ERG binds to both ETS sites 1 and 2, we mutated each one individually in the '1/2' oligonucleotide. Mutation of either ETS site 1 or 2 resulted in similarly reduced ERG binding (Fig. 2C), indicating that ERG can interact with ETS sites 1 and 2 with comparable affinity. Likewise, we observed that mutation of either ETS site 6 or 7 reduced ERG binding to the 32P-labeled '6/7' oligonucleotide (Fig. 2C). However, whereas mutation of ETS site 7 somewhat reduced DNA-binding, mutation of ETS site 6 completely abolished DNA-binding, suggesting that ERG binding to ETS site 7 is dependent on the integrity of ETS site 6. yap_site6-erg-1 1 6 competitor competitor competitor unspecified role unspecified role purified purified G_G22-23C_C mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain GG CC human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. 8 unspecified role unspecified role prey prey over-expressed over expressed level over-expressed cell lysate cell lysate c_terminus myc tag myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range chemical synthesis Chemical synthesis (Chemical synthesis) 7 unspecified role unspecified role bait bait purified purified 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 2 D E74 and mE74 sequences have been retrieved from reference PMID:15780752 erg-kdm4a-1 3 4 unspecified role unspecified role prey prey over-expressed over expressed level over-expressed living cell living cell ha tag ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 8 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell myc tag myc tag myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range flag tag FLAG tag flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged c-term range C-terminal range c-term range c-term range C-terminal range c-term range human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. physical association physical association Fig. 5A erg-kdm4a-2 2 4 unspecified role unspecified role prey prey purified purified His tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range flag tag flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range spofr Spodoptera frugiperda (Fall armyworm) Fall armyworm 8 unspecified role unspecified role bait bait purified purified gst tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Fig. 5B erg-e74_dna_probe-1 1 6 unspecified role unspecified role bait bait purified purified 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 8 unspecified role unspecified role prey prey over-expressed over expressed level over-expressed cell lysate cell lysate c_terminus myc tag myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. physical association physical association Fig. 2 C/D E74 and mE74 sequences have been retrieved from reference PMID:15780752 positive control yap1_human_ets_site6/7_dna_probe-e74_dna_probe-1 1 6 competitor competitor competitor unspecified role unspecified role purified purified G_G22-23C_C mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain GG CC chemical synthesis Chemical synthesis (Chemical synthesis) 8 unspecified role unspecified role prey prey over-expressed over expressed level over-expressed cell lysate cell lysate c_terminus myc tag myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. 5 unspecified role unspecified role bait bait purified purified 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 2 D E74 and mE74 sequences have been retrieved from reference PMID:15780752 e74_dna_probe-e74_dna_probe-1 1 6 competitor competitor competitor unspecified role unspecified role purified purified G_G22-23C_C mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain GG CC chemical synthesis Chemical synthesis (Chemical synthesis) 8 unspecified role unspecified role prey prey over-expressed over expressed level over-expressed cell lysate cell lysate c_terminus myc tag myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. 6 unspecified role unspecified role bait bait purified purified 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 2 D E74 and mE74 sequences have been retrieved from reference PMID:15780752