MINT MINT, Dpt of Biology, University of Rome Tor Vergata MINT http://mint.bio.uniroma2.it/mint url>http://mint.bio.uniroma2.it/mint/ https://mint.bio.uniroma2.it MINT-[0-9]+ https://mint.bio.uniroma2.it/index.php/results-interactions/?id=${ac} The Molecular INTeraction database (MINT) is a relational database designed to store interactions between biological molecules. http://mint.bio.uniroma2.it Identification of TSG101 functional domains and p21 loci required for TSG101-mediated p21 gene regulation. Identification of TSG101 functional domains and p21 loci required for TSG101-mediated p21 gene regulation. PloS one 2012 imex curation Lin YS., Chen YJ., Cohen SN., Cheng TH. thcheng@ym.edu.tw 09-May-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-saos-2 Homo sapiens SAOS-2 cell line established from primary osteogenic sarcoma saos-2 Homo sapiens SAOS-2 cell line established from primary osteogenic sarcoma ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Lin YS., Chen YJ., Cohen SN., Cheng TH. thcheng@ym.edu.tw Accepted 2018-JUL-25 AT 09:07 BST AT 09:07 BST by ORCHARD PloS one 2012 imex curation cdkn1a_human_gene Human CDKN1A gene gene gene human Homo sapiens Human ts101_human Tumor susceptibility gene 101 protein TSG101 ESCRT-I complex subunit TSG101 protein protein human Homo sapiens Human MAVSESQLKKMVSKYKYRDLTVRETVNVITLYKDLKPVLDSYVFNDGSSRELMNLTGTIPVPYRGNTYNIPICLWLLDTYPYNPPICFVKPTSSMTIKTGKHVDANGKIYLPYLHEWKHPQSDLLGLIQVMIVVFGDEPPVFSRPISASYPPYQATGPPNTSYMPGMPGGISPYPSGYPPNPSGYPGCPYPPGGPYPATTSSQYPSQPPVTTVGPSRDGTISEDTIRASLISAVSDKLRWRMKEEMDRAQAELNALKRTEEDLKKGHQKLEEMVTRLDQEVAEVDKNIELLKKKDEELSSALEKMENQSENNDIDEVIIPTAPLYKQILNLYAEENAIEDTIFYLGEALRRGVIDLDVFLKHVRLLSRKQFQLRALMQKARKTAGLSDLY ADD6912FC22DF162 tsg101-cdkn1a_human_gene-1 1 2 unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep physiological level physiological level endogenous level endogenous endogenous endogenous level promoter region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined CAGCCTGCTCCCTTGCCTTTTTCA GACCCCACTCTAAGCCCCACTGC 3 unspecified role unspecified role bait bait subcellular prep subcellular preparation subcellular prep physiological level physiological level endogenous level endogenous endogenous endogenous level binding region binding region required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain physical association physical association f3a f4b Chromatin immunoprecipitation (ChIP) assays showed that sequences of the p21 promoter region interact directly with the TSG101 protein and identified the TSG101-binding sequence in Saos-2 as the region amplified by primer set “d” (Fig 3A). However, failure of a construct containing only the UEV domain to bind indicates that at the presence of either the PR or CC domain enables binding. Collectively these findings indicate that TSG101 contains more than one locus that allows it to interact with the p21 promoter. Chromatin immunoprecipitation (ChIP) assays showed that sequences of the p21 promoter region interact directly with the TSG101 protein and identified the TSG101-binding sequence in Saos-2 as the region amplified by primer set “d” (Fig 3A). Q99816 activates ENSG00000124762 down-regulates activity