NTNU NTNU, Norwegian University of Science and Technology www.ntnu.no/home c-Myc represses FOXO3a-mediated transcription of the gene encoding the p27(Kip1) cyclin dependent kinase inhibitor. c-Myc represses FOXO3a-mediated transcription of the gene encoding the p27(Kip1) cyclin dependent kinase inhibitor. Journal of cellular biochemistry 2008 imex curation Chandramohan V., Mineva ND., Burke B., Jeay S., Wu M., Shen J., Yang W., Hann SR., Sonenshein GE. Gail.Sonenshein@tufts.edu 8-Jun-2017: Contacted by IntAct-Help. in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Chandramohan V., Mineva ND., Burke B., Jeay S., Wu M., Shen J., Yang W., Hann SR., Sonenshein GE. Gail.Sonenshein@tufts.edu Accepted 2017-JUN-01 AT 10:09 BST AT 10:09 BST by ORCHARD Journal of cellular biochemistry 2008 imex curation hi Sandra, I think that I have now corrected most issues c-Myc represses FOXO3a-mediated transcription of the gene encoding the p27(Kip1) cyclin dependent kinase inhibitor. c-Myc represses FOXO3a-mediated transcription of the gene encoding the p27(Kip1) cyclin dependent kinase inhibitor. Journal of cellular biochemistry 2008 imex curation Chandramohan V., Mineva ND., Burke B., Jeay S., Wu M., Shen J., Yang W., Hann SR., Sonenshein GE. Gail.Sonenshein@tufts.edu 8-Jun-2017: Contacted by IntAct-Help. in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Chandramohan V., Mineva ND., Burke B., Jeay S., Wu M., Shen J., Yang W., Hann SR., Sonenshein GE. Gail.Sonenshein@tufts.edu Accepted 2017-JUN-01 AT 10:09 BST AT 10:09 BST by ORCHARD Journal of cellular biochemistry 2008 imex curation hi Sandra, I think that I have now corrected most issues c-Myc represses FOXO3a-mediated transcription of the gene encoding the p27(Kip1) cyclin dependent kinase inhibitor. c-Myc represses FOXO3a-mediated transcription of the gene encoding the p27(Kip1) cyclin dependent kinase inhibitor. Journal of cellular biochemistry 2008 imex curation Chandramohan V., Mineva ND., Burke B., Jeay S., Wu M., Shen J., Yang W., Hann SR., Sonenshein GE. Gail.Sonenshein@tufts.edu 8-Jun-2017: Contacted by IntAct-Help. mouse-nih_3t3 Mus musculus Swiss NIH 3t3 embryo fibroblast cells nih_3t3 Mouse Swiss NIH embryo contact inhibited fibroblast cells anti tag coip anti tag coimmunoprecipitation anti tag coip western blot western blot Immuno blot Immuno blot Chandramohan V., Mineva ND., Burke B., Jeay S., Wu M., Shen J., Yang W., Hann SR., Sonenshein GE. Gail.Sonenshein@tufts.edu Accepted 2017-JUN-01 AT 10:09 BST AT 10:09 BST by ORCHARD Journal of cellular biochemistry 2008 imex curation hi Sandra, I think that I have now corrected most issues Mock publication and experiment for abstract interactions that are not interaction evidences. Mock publication and experiment for abstract interactions that are not interaction evidences. unspecified method c-Myc represses FOXO3a-mediated transcription of the gene encoding the p27(Kip1) cyclin dependent kinase inhibitor. c-Myc represses FOXO3a-mediated transcription of the gene encoding the p27(Kip1) cyclin dependent kinase inhibitor. Journal of cellular biochemistry 2008 imex curation Chandramohan V., Mineva ND., Burke B., Jeay S., Wu M., Shen J., Yang W., Hann SR., Sonenshein GE. Gail.Sonenshein@tufts.edu 8-Jun-2017: Contacted by IntAct-Help. mouse-wehi_231 mouse B-cell lymphoma WEHI-231 Mouse wehi_231 Mouse B-cell lymphoma line WEHI-231 anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Chandramohan V., Mineva ND., Burke B., Jeay S., Wu M., Shen J., Yang W., Hann SR., Sonenshein GE. Gail.Sonenshein@tufts.edu Accepted 2017-JUN-01 AT 10:09 BST AT 10:09 BST by ORCHARD Journal of cellular biochemistry 2008 imex curation hi Sandra, I think that I have now corrected most issues c-Myc represses FOXO3a-mediated transcription of the gene encoding the p27(Kip1) cyclin dependent kinase inhibitor. c-Myc represses FOXO3a-mediated transcription of the gene encoding the p27(Kip1) cyclin dependent kinase inhibitor. Journal of cellular biochemistry 2008 imex curation Chandramohan V., Mineva ND., Burke B., Jeay S., Wu M., Shen J., Yang W., Hann SR., Sonenshein GE. Gail.Sonenshein@tufts.edu 8-Jun-2017: Contacted by IntAct-Help. mouse-nih_3t3 Mus musculus Swiss NIH 3t3 embryo fibroblast cells nih_3t3 Mouse Swiss NIH embryo contact inhibited fibroblast cells anti bait coip anti bait coimmunoprecipitation anti bait coip anti tag western anti tag western blot anti tag western Chandramohan V., Mineva ND., Burke B., Jeay S., Wu M., Shen J., Yang W., Hann SR., Sonenshein GE. Figure 2A Gail.Sonenshein@tufts.edu Accepted 2017-JUN-01 AT 10:09 BST AT 10:09 BST by ORCHARD Journal of cellular biochemistry 2008 imex curation hi Sandra, I think that I have now corrected most issues c-Myc represses FOXO3a-mediated transcription of the gene encoding the p27(Kip1) cyclin dependent kinase inhibitor. c-Myc represses FOXO3a-mediated transcription of the gene encoding the p27(Kip1) cyclin dependent kinase inhibitor. Journal of cellular biochemistry 2008 imex curation Chandramohan V., Mineva ND., Burke B., Jeay S., Wu M., Shen J., Yang W., Hann SR., Sonenshein GE. Gail.Sonenshein@tufts.edu 8-Jun-2017: Contacted by IntAct-Help. mouse-wehi_231 mouse B-cell lymphoma WEHI-231 Mouse wehi_231 Mouse B-cell lymphoma line WEHI-231 ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Chandramohan V., Mineva ND., Burke B., Jeay S., Wu M., Shen J., Yang W., Hann SR., Sonenshein GE. Gail.Sonenshein@tufts.edu Accepted 2017-JUN-01 AT 10:09 BST AT 10:09 BST by ORCHARD Journal of cellular biochemistry 2008 imex curation hi Sandra, I think that I have now corrected most issues myc_human Myc proto-oncogene protein BHLHE39 Transcription factor p64 MYC Proto-oncogene c-Myc Class E basic helix-loop-helix protein 39 protein protein human Homo sapiens Human MPLNVSFTNRNYDLDYDSVQPYFYCDEEENFYQQQQQSELQPPAPSEDIWKKFELLPTPPLSPSRRSGLCSPSYVAVTPFSLRGDNDGGGGSFSTADQLEMVTELLGGDMVNQSFICDPDDETFIKNIIIQDCMWSGFSAAAKLVSEKLASYQAARKDSGSPNPARGHSVCSTSSLYLQDLSAAASECIDPSVVFPYPLNDSSSPKSCASQDSSAFSPSSDSLLSSTESSPQGSPEPLVLHEETPPTTSSDSEEEQEDEEEIDVVSVEKRQAPGKRSESGSPSAGGHSKPPHSPLVLKRCHVSTHQHNYAAPPSTRKDYPAAKRVKLDSVRVLRQISNNRKCTSPRSSDTEENVKRRTHNVLERQRRNELKRSFFALRDQIPELENNEKAPKVVILKKATAYILSVQAEEQKLISEEDLLRKRREQLKHKLEQLRNSCA DIP protein P01106 original sequence version: 195 DIP protein P01106 original sequence version: 196 DIP protein P01106 original sequence version: 148 DIP protein P01106-1 original sequence version: 161 DIP protein P01106 original sequence version: 182 DIP protein P01106 original sequence version: 197 DIP protein P01106-1 original sequence version: 208 DIP protein P01106 original sequence version: 121 DIP protein P01106-1 original sequence version: 144 DIP protein P01106 original sequence version: 144 ED5C028029A4C5D1 f6s3z3_mouse_gene Cad gene gene mouse Mus musculus Mouse cdn1b_mouse_gene Cyclin-dependent kinase inhibitor 1B Cdkn1b gene gene mouse Mus musculus Mouse foxo3_mouse Forkhead box protein O3 Foxo3 Fkhr2 Foxo3a protein protein mouse Mus musculus Mouse MAEAPASPVPLSPLEVELDPEFEPQSRPRSCTWPLQRPELQASPAKPSGETAADSMIPEEDDDEDDEDGGGRASSAMVIGGGVSSTLGSGLLLEDSAMLLAPGGQDLGSGPASAAGALSGGTPTQLQPQQPLPQPQPGAAGGSGQPRKCSSRRNAWGNLSYADLITRAIESSPDKRLTLSQIYEWMVRCVPYFKDKGDSNSSAGWKNSIRHNLSLHSRFMRVQNEGTGKSSWWIINPDGGKSGKAPRRRAVSMDNSNKYTKSRGRAAKKKAALQAAPESADDSPSQLSKWPGSPTSRSSDELDAWTDFRSRTNSNASTVSGRLSPILASTELDDVQDDDGPLSPMLYSSSASLSPSVSKPCTVELPRLTDMAGTMNLNDGLAENLMDDLLDNIALPPSQPSPPGGLMQRGSSFPYTAKSSGLGSPTGSFNSTVFGPSSLNSLRQSPMQTIQENRPATFSSVSHYGNQTLQDLLASDSLSHSDVMMTQSDPLMSQASTAVSAQNARRNVMLRNDPMMSFAAQPTQGSLVNQNLLHHQHQTQGALGGSRALSNSVSNMGLSDSSSLGSAKHQQQSPASQSMQTLSDSLSGSSLYSASANLPVMGHDKFPSDLDLDMFNGSLECDMESIIRSELMDADGLDFNFDSLISTQNVVGLNVGNFTGAKQASSQSWVPG EC218D9BA0C1DAC5 myc_mouse Myc proto-oncogene protein Proto-oncogene c-Myc Transcription factor p64 Myc protein protein mouse Mus musculus Mouse MPLNVNFTNRNYDLDYDSVQPYFICDEEENFYHQQQQSELQPPAPSEDIWKKFELLPTPPLSPSRRSGLCSPSYVAVATSFSPREDDDGGGGNFSTADQLEMMTELLGGDMVNQSFICDPDDETFIKNIIIQDCMWSGFSAAAKLVSEKLASYQAARKDSTSLSPARGHSVCSTSSLYLQDLTAAASECIDPSVVFPYPLNDSSSPKSCTSSDSTAFSPSSDSLLSSESSPRASPEPLVLHEETPPTTSSDSEEEQEDEEEIDVVSVEKRQTPAKRSESGSSPSRGHSKPPHSPLVLKRCHVSTHQHNYAAPPSTRKDYPAAKRAKLDSGRVLKQISNNRKCSSPRSSDTEENDKRRTHNVLERQRRNELKRSFFALRDQIPELENNEKAPKVVILKKATAYILSIQADEHKLTSEKDLLRKRREQLKHKLEQLRNSGA DIP protein P01108 original sequence version: 146 DIP protein P01108 original sequence version: 167 3FCA39BFFD6FC59E foxo3_human Forkhead box protein O3 FOXO3 FKHRL1 FOXO3A Forkhead in rhabdomyosarcoma-like 1 AF6q21 protein protein protein human Homo sapiens Human MAEAPASPAPLSPLEVELDPEFEPQSRPRSCTWPLQRPELQASPAKPSGETAADSMIPEEEDDEDDEDGGGRAGSAMAIGGGGGSGTLGSGLLLEDSARVLAPGGQDPGSGPATAAGGLSGGTQALLQPQQPLPPPQPGAAGGSGQPRKCSSRRNAWGNLSYADLITRAIESSPDKRLTLSQIYEWMVRCVPYFKDKGDSNSSAGWKNSIRHNLSLHSRFMRVQNEGTGKSSWWIINPDGGKSGKAPRRRAVSMDNSNKYTKSRGRAAKKKAALQTAPESADDSPSQLSKWPGSPTSRSSDELDAWTDFRSRTNSNASTVSGRLSPIMASTELDEVQDDDAPLSPMLYSSSASLSPSVSKPCTVELPRLTDMAGTMNLNDGLTENLMDDLLDNITLPPSQPSPTGGLMQRSSSFPYTTKGSGLGSPTSSFNSTVFGPSSLNSLRQSPMQTIQENKPATFSSMSHYGNQTLQDLLTSDSLSHSDVMMTQSDPLMSQASTAVSAQNSRRNVMLRNDPMMSFAAQPNQGSLVNQNLLHHQHQTQGALGGSRALSNSVSNMGLSESSSLGSAKHQQQSPVSQSMQTLSDSLSGSSLYSTSANLPVMGHEKFPSDLDLDMFNGSLECDMESIIRSELMDADGLDFNFDSLISTQNVVGLNVGNFTGAKQASSQSWVPG E5B4E830665A9982 DIP protein O43524 original sequence version: 82 E5B4E830665A9982 max_mouse Protein max Myc-associated factor X Protein myn Myc-binding novel HLH/LZ protein Max Myn protein protein mouse Mus musculus Mouse MSDNDDIEVESDEEQPRFQSAADKRAHHNALERKRRDHIKDSFHSLRDSVPSLQGEKASRAQILDKATEYIQYMRRKNHTHQQDIDDLKRQNALLEQQVRALEKARSSAQLQTNYPSSDNSLYTNAKGGTISAFDGGSDSSSESEPEEPQSRKKLRMEAS 86D133137727A57A myc-foxo3-1 6 13 unspecified role unspecified role bait bait C-terminus v5 tag v5 tag GKPIPNPLLGLDST epitope tag GKPIPNPLLGLDST epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range N-terminus-region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 8 unspecified role unspecified role prey prey myc LZ deletion myc LZ deletion sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 20 18 physical association physical association Figure 2a/2f foxo3-myc-1 3 8 unspecified role unspecified role prey prey 13 unspecified role unspecified role bait bait C-terminus v5 tag v5 tag GKPIPNPLLGLDST epitope tag GKPIPNPLLGLDST epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range physical association physical association Figure 2b cdkn1b-foxo3-1 2 13 unspecified role unspecified role prey prey partially purified partially purified region foxo3 gst-tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined GST-FOXO3 was expressed in E.coli and partially purified 10 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined cdkn1b_mouse_promoter_oligo wt oligo from mouse cdkn1b promoter sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined cdkn1b mouse emsa oligo is from the promoter region, minus 110-minus 83; according to BLAT, it is chr6:134920599-134920625 direct interaction direct interaction Figure 3b/3e/3f/3g myc(protein)-cdkn1b(gene)-1 1 10 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined oligo from cdkn1b promoter, minus 110 to minus 83; CGCTCCGACTGTTTGCCACCTCCTCCT, chr6:134920599-134920625 mouse Mus musculus Mouse 12 unspecified role unspecified role prey prey mouse-wehi_231 mouse B-cell lymphoma WEHI-231 Mouse wehi_231 Mouse B-cell lymphoma line WEHI-231 physical association physical association Figure 3h Myc is endogenous in mouse cell line WEHI 231 anti-IgM cdkn1b-foxo3-2 7 10 unspecified role unspecified role prey prey cdkn1b promoter binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 11 unspecified role unspecified role bait bait association association Figure 5a binding of FOXO3 to cdkn1b promotoer increases with time after anti_IgM-treatment, wherease binding of Myc and Max to the cdkn1b promoter decreases in the same time period (0-8h) anti-IgM cdkn1b-myc-1 7 10 unspecified role unspecified role prey prey cdkn1b promoter cdkn1b promoter binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 12 unspecified role unspecified role bait bait association association Figure 5a binding of FOXO3 to cdkn1b promotoer increases with time after anti_IgM-treatment, wherease binding of Myc and Max to the cdkn1b promoter decreases in the same time period (0-8h) foxo3-myc-2 5 12 unspecified role unspecified role prey prey 11 unspecified role unspecified role bait bait physical association physical association Figure 2c anti-IgM foxo3-myc complex appears after 8h treatment with anti-IgM cdkn1b-max-1 7 14 unspecified role unspecified role bait bait 10 unspecified role unspecified role prey prey cdkn1b promoter binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association binding of FOXO3 to cdkn1b promotoer increases with time after anti_IgM-treatment, wherease binding of Myc and Max to the cdkn1b promoter decreases in the same time period (0-8h) Figure 5a anti-IgM complex foxo3-myc cdkn1b-1 2 52 unspecified role unspecified role prey prey region gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in the complex foxo3-myc, each of foxo3 and myc have GST-tags myc LZ deletion sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain both foxo3 and myc have gst-tags foxo3-myc complex with myc-LZ-deletion mutant can still bind the cdkn1b promoter oligo 10 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined mut3 mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined MutCont mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined cdkn1b-promoter-oligo-wt sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain cdkn1b mouse emsa oligo is from the promoter region, minus 110-minus 83; according to BLAT, it is chr6:134920599-134920625 direct interaction direct interaction Figure 3e/3f/3g Max: Figure 3e shows the experiment indicating that addition of GST-Max to the emsa binding reaction has no discerneable effect on foxo3-myc complex formation with the cdkn1b promoter oligo (-110-region) (last lane in FIgure 3e); also it shows that GST-Max alone does not bind the cdkn1b oligo (FIgure 3e, lane 5) GST-myc, when added to the emsa binding reaction with cdkn1b -110 promoter wt oligo, in the absence of foxo3, does not bind to the oligo: Figure 3e lane 4; Figure 3f, lane 4 foxo3-myc-4 6 8 unspecified role unspecified role prey prey 13 unspecified role unspecified role bait bait region v5 tag v5 tag GKPIPNPLLGLDST epitope tag GKPIPNPLLGLDST epitope tag certain certain sequence position certain certain certain sequence position certain physical association physical association Figure 2f foxo3-myc-5 3 12 unspecified role unspecified role prey prey myc LZ deletion sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 13 unspecified role unspecified role bait bait Foxo3 DNA-binding sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain C-terminus v5 tag v5 tag GKPIPNPLLGLDST epitope tag GKPIPNPLLGLDST epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range 66 68 physical association physical association Figure 2e/2g cdkn1b-foxo3-6 2 10 competitor competitor competitor prey prey cdkn1b_mouse_promoter_oligo wt oligo from mouse cdkn1b promoter sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined cdkn1b mouse emsa oligo is from the promoter region, minus 110-minus 83; according to BLAT, it is chr6:134920599-134920625 13 unspecified role unspecified role prey prey partially purified partially purified region foxo3 gst-tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined GST-FOXO3 was expressed in E.coli and partially purified 10 unspecified role unspecified role bait bait cdkn1b_mouse_promoter_oligo wt oligo from mouse cdkn1b promoter sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined cdkn1b mouse emsa oligo is from the promoter region, minus 110-minus 83; according to BLAT, it is chr6:134920599-134920625 region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined direct interaction direct interaction Figure 3b -2 cdkn1b-cdkn1b-1 2 10 competitor competitor competitor prey prey igfbp1-IRS-promoter-oligo oligo with FOXO3-site from IGFBP1-promoter sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined cdkn1b mouse emsa oligo is from the promoter region, minus 110-minus 83; according to BLAT, it is chr6:134920599-134920625 IRS competitor from IGFBP1 gene promoter is according to reference Brunet et al 1999, PMID: 10102273 13 unspecified role unspecified role prey prey partially purified partially purified region foxo3 gst-tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined GST-FOXO3 was expressed in E.coli and partially purified 10 unspecified role unspecified role bait bait cdkn1b_mouse_promoter_oligo wt oligo from mouse cdkn1b promoter sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined cdkn1b mouse emsa oligo is from the promoter region, minus 110-minus 83; according to BLAT, it is chr6:134920599-134920625 region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined direct interaction direct interaction Figure 3b -3 cad-myc-1 7 9 unspecified role unspecified role prey prey cad promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 12 unspecified role unspecified role bait bait association association Figure 5c anti-IgM gene name is cad_mouse "carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase" max-cad-1 7 14 unspecified role unspecified role bait bait 9 unspecified role unspecified role prey prey cad promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Figure 5c anti-IgM gene name is cad_mouse "carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase" foxo3-myc_human FOXO3-MYC complex FOXO3:MYC 8 unspecified role unspecified role foxo3 binding region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain 13 unspecified role unspecified role myc binding region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain 95 97 direct interaction direct interaction human Homo sapiens Human stable complex stable complex physical interaction evidence used in manual assertion physical interaction evidence used in manual assertion IPI inferred from physical interaction A transcription factor repressor complex involved in regulating cell proliferation by repressing transcription of genes involved in negative regulation of mitotic cell cycle. The interaction of MYC with FOXO3 is likely to occur at the target gene promoter and inhibits FOXO3s activating effect on target gene transcription. The half life of the FOXO3-MYC complex is not known, but most likely to be of limited time span, in line with rapid dynamics of changes in transcription regulation in response to internal and external cues. Another variant of FOXO3-MYC interaction has been observed where FOXO3 seems to facilitate displacement of MYC from its promoters, thereby antagonizing MYC function in metabolic adaption to hypoxia. Interaction with DNA is specifically via FOXO3 subunit. Accepted 2017-JUN-07 by ORCHARD