NTNU NTNU, Norwegian University of Science and Technology www.ntnu.no/home FOXO transcription factors directly activate bim gene expression and promote apoptosis in sympathetic neurons. FOXO transcription factors directly activate bim gene expression and promote apoptosis in sympathetic neurons. The Journal of cell biology 2003 imex curation Gilley J., Coffer PJ., Ham J. J.Ham@ich.ucl.ac.uk 14-Jul-2017: Contacted by IntAct-Help. in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Gilley J., Coffer PJ., Ham J. J.Ham@ich.ucl.ac.uk Accepted 2017-JUN-12 AT 10:22 BST AT 10:22 BST by ORCHARD The Journal of cell biology 2003 imex curation tnfl6_human_gene Tumor necrosis factor ligand superfamily member 6 (FASLG) human gene gene gene human Homo sapiens Human bim_human_gene Human Bim gene gene gene human Homo sapiens Human foxo3_human Forkhead box protein O3 FOXO3 FKHRL1 FOXO3A Forkhead in rhabdomyosarcoma-like 1 AF6q21 protein protein protein human Homo sapiens Human MAEAPASPAPLSPLEVELDPEFEPQSRPRSCTWPLQRPELQASPAKPSGETAADSMIPEEEDDEDDEDGGGRAGSAMAIGGGGGSGTLGSGLLLEDSARVLAPGGQDPGSGPATAAGGLSGGTQALLQPQQPLPPPQPGAAGGSGQPRKCSSRRNAWGNLSYADLITRAIESSPDKRLTLSQIYEWMVRCVPYFKDKGDSNSSAGWKNSIRHNLSLHSRFMRVQNEGTGKSSWWIINPDGGKSGKAPRRRAVSMDNSNKYTKSRGRAAKKKAALQTAPESADDSPSQLSKWPGSPTSRSSDELDAWTDFRSRTNSNASTVSGRLSPIMASTELDEVQDDDAPLSPMLYSSSASLSPSVSKPCTVELPRLTDMAGTMNLNDGLTENLMDDLLDNITLPPSQPSPTGGLMQRSSSFPYTTKGSGLGSPTSSFNSTVFGPSSLNSLRQSPMQTIQENKPATFSSMSHYGNQTLQDLLTSDSLSHSDVMMTQSDPLMSQASTAVSAQNSRRNVMLRNDPMMSFAAQPNQGSLVNQNLLHHQHQTQGALGGSRALSNSVSNMGLSESSSLGSAKHQQQSPVSQSMQTLSDSLSGSSLYSTSANLPVMGHEKFPSDLDLDMFNGSLECDMESIIRSELMDADGLDFNFDSLISTQNVVGLNVGNFTGAKQASSQSWVPG E5B4E830665A9982 DIP protein O43524 original sequence version: 82 E5B4E830665A9982 foxo3-faslg-1 1 2 unspecified role unspecified role bait bait promoter region required to bind necessary binding region required to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined CTAGAATAAGTAAATAAATAA CTAGTTATTTATTTACTTATT region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role prey prey partially purified partially purified foxo3-DBD sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain n-terminal GST tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Figure 5b bim_human_gene-foxo3-1 1 4 unspecified role unspecified role prey prey partially purified partially purified N-terminal tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range foxo3-DBD sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 3 unspecified role unspecified role bait bait promoter region required to bind necessary binding region required to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined CTAGCTAGGGTAAACACGCCG CTAGCGGCGTGTTTACCCTAG CTAGGCAAGGTAAACACTCCT CTAGAGGAGTGTTTACCTTGC mutated promoter region mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined direct interaction direct interaction Figure 5b O43524 (GO:0001228) up-regulates quantity by expression ENSG00000153094 P01139 (GO:0004871) down-regulates quantity by expression ENSG00000153094 CHEBI:65329 up-regulates quantity by expression ENSG00000153094 foxo3-6 1 2 competitor competitor competitor prey prey promoter region required to bind necessary binding region required to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined CTAGAATAAGTAAATAAATAA CTAGTTATTTATTTACTTATT 2 unspecified role unspecified role bait bait promoter region required to bind necessary binding region required to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined CTAGAATAAGTAAATAAATAA CTAGTTATTTATTTACTTATT region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role prey prey partially purified partially purified foxo3-DBD sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain n-terminal GST tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Figure 5b_ foxo3-7 1 3 competitor competitor competitor prey prey promoter region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined CTAGCTAGGGTAAACACGCCG CTAGCGGCGTGTTTACCCTAG 2 unspecified role unspecified role bait bait promoter region required to bind necessary binding region required to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined CTAGAATAAGTAAATAAATAA CTAGTTATTTATTTACTTATT region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role prey prey partially purified partially purified foxo3-DBD sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain n-terminal GST tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Figure 5b_2 bim_human_gene-1 1 3 competitor competitor competitor prey prey promoter region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined CTAGGCAAGGTAAACACTCCT CTAGAGGAGTGTTTACCTTGC 2 unspecified role unspecified role bait bait promoter region required to bind necessary binding region required to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined CTAGAATAAGTAAATAAATAA CTAGTTATTTATTTACTTATT region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role prey prey partially purified partially purified foxo3-DBD sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain n-terminal GST tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Figure 5b_3