IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Recruitment of intron-encoded and co-opted proteins in splicing of the bI3 group I intron RNA. Recruitment of intron-encoded and co-opted proteins in splicing of the bI3 group I intron RNA. Proceedings of the National Academy of Sciences of the United States of America 2002 imex curation Bassi GS., de Oliveira DM., White MF., Weeks KM. 6.3 Nucleic Acids IntAct policy is only to annotate interactions involving nucleic acids when either the sequence is given in the publication or an exact match can be found in the ENA database. and 9.3 Nucleic Acid Nucleic acids are normally only created if a sequence is available or if an exact match for the sequence can be found in ENA or another nucleotide sequence weeks@unc.edu 09-May-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro nuclease assay nuclease assay predetermined predetermined participant predetermined Bassi GS., de Oliveira DM., White MF., Weeks KM. 6.3 Nucleic Acids IntAct policy is only to annotate interactions involving nucleic acids when either the sequence is given in the publication or an exact match can be found in the ENA database. and 9.3 Nucleic Acid Nucleic acids are normally only created if a sequence is available or if an exact match for the sequence can be found in ENA or another nucleotide sequence Reaction kinetics are most accurately followed using a 5′-32P-end-labeled RNA precursor and a pG nucleophile. To observe potentially inefficient self-splicing reactions, we also followed splicing by using the sensitive approach of detecting addition of [32P]-GTP to unlabeled RNA. weeks@unc.edu Accepted 2018-MAY-10 AT 08:57 BST AT 08:57 BST by MGT Proceedings of the National Academy of Sciences of the United States of America 2002 imex curation I've added the 3E results as a separate experiment, though I'm not sure if it is experimentally different, or just a recalculation of the same results. Recruitment of intron-encoded and co-opted proteins in splicing of the bI3 group I intron RNA. Recruitment of intron-encoded and co-opted proteins in splicing of the bI3 group I intron RNA. Proceedings of the National Academy of Sciences of the United States of America 2002 imex curation Bassi GS., de Oliveira DM., White MF., Weeks KM. 6.3 Nucleic Acids IntAct policy is only to annotate interactions involving nucleic acids when either the sequence is given in the publication or an exact match can be found in the ENA database. and 9.3 Nucleic Acid Nucleic acids are normally only created if a sequence is available or if an exact match for the sequence can be found in ENA or another nucleotide sequence weeks@unc.edu 09-May-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro solution sedimentati cosedimentation in solution solution sedimentati predetermined predetermined participant predetermined Bassi GS., de Oliveira DM., White MF., Weeks KM. 6.3 Nucleic Acids IntAct policy is only to annotate interactions involving nucleic acids when either the sequence is given in the publication or an exact match can be found in the ENA database. and 9.3 Nucleic Acid Nucleic acids are normally only created if a sequence is available or if an exact match for the sequence can be found in ENA or another nucleotide sequence Reaction kinetics are most accurately followed using a 5′-32P-end-labeled RNA precursor and a pG nucleophile. To observe potentially inefficient self-splicing reactions, we also followed splicing by using the sensitive approach of detecting addition of [32P]-GTP to unlabeled RNA. weeks@unc.edu Accepted 2018-MAY-10 AT 08:57 BST AT 08:57 BST by MGT Proceedings of the National Academy of Sciences of the United States of America 2002 imex curation I've added the 3E results as a separate experiment, though I'm not sure if it is experimentally different, or just a recalculation of the same results. Recruitment of intron-encoded and co-opted proteins in splicing of the bI3 group I intron RNA. Recruitment of intron-encoded and co-opted proteins in splicing of the bI3 group I intron RNA. Proceedings of the National Academy of Sciences of the United States of America 2002 imex curation Bassi GS., de Oliveira DM., White MF., Weeks KM. 6.3 Nucleic Acids IntAct policy is only to annotate interactions involving nucleic acids when either the sequence is given in the publication or an exact match can be found in the ENA database. and 9.3 Nucleic Acid Nucleic acids are normally only created if a sequence is available or if an exact match for the sequence can be found in ENA or another nucleotide sequence weeks@unc.edu 09-May-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro filter binding filter binding Filter overlay assay Filter overlay assay predetermined predetermined participant predetermined Bassi GS., de Oliveira DM., White MF., Weeks KM. 6.3 Nucleic Acids IntAct policy is only to annotate interactions involving nucleic acids when either the sequence is given in the publication or an exact match can be found in the ENA database. and 9.3 Nucleic Acid Nucleic acids are normally only created if a sequence is available or if an exact match for the sequence can be found in ENA or another nucleotide sequence weeks@unc.edu Accepted 2018-MAY-10 AT 08:57 BST AT 08:57 BST by MGT Proceedings of the National Academy of Sciences of the United States of America 2002 imex curation I've added the 3E results as a separate experiment, though I'm not sure if it is experimentally different, or just a recalculation of the same results. mbi3_yeast Cytochrome b mRNA maturase bI3 BI3 Q0115 protein protein yeast Saccharomyces cerevisiae Baker's yeast MAFRKSNVYLSLVNSYIIDSPQPSSINYWWNMGSLLGLCLVIQIVTGIFMAMHYSSNIELAFSSVEHIMRDVHNGYILRYLHANGASFFFMVMFMHMAKGLYYGSYRSPRVTLWNVGVIIFILTIATAFLGYCCVYGQMSHWGATVITNLFSAIPFVGNDIVSWLWGGFNMEDPYYSNMMLNKSVLCWNIFIWMMNYYIIQLIIYNNMIWNKNNMVKMFIMRRKLAVINMYMYMKLIIQRTYSYYMNNTIIYDKNHKLNTDNPIYAYIGGLFEGDGWITISKKGKYLLYELGIEMHIRDIQLLYKIKNILGIGKVTIKKLKMKDGTIKEMCKFNVRNKNHLKNIIIPIFDKYPMLTNKHYDYLYFKDNLLKDIKYYNDLSYYLRPIKPFNTTEDILNKNYFSSWLIGFFEAESCFSIYKPMNKKMKTASFEVSQNNSMEVMLAIKSYLKITQNIYTDKFNNSRMTTKSINGIKNVVMFINNNPIKLLGYKKLQYLLFLKDLRTITKYNNYFKIPPKY FBCE3D178D92D850 bi3_intron_yeast_mrna bi3 intron mRNA mrna messenger rna mRNA mrna yeast Saccharomyces cerevisiae Baker's yeast UAAUAUAGAGGAUCCAUAUUAUAGUAAUAUAAUAUUAAAUAAAUCUGUUUUAUGCUGAAAUAUCUUCAUUUGAAUAAUAAAUUACUAUAUUAUUCAAUUAAUUAUUUAUAAUAAUAUAAUUUGAAAUAAAAAUAAUAUAGUUAAAAUAUUUAUUAUAAGAAGAAAAUUAGCAGUAAUUAAUAUAUAUAUAUAUAUAAAAUUAAUUAUUCAGAGACUUUAUAGUUAUUAUAUAAAUAAUACUAUUAUUUAUGAUAAAAAUCAUAAAUUAAACACAGAUAAUCCUAUUUAUGCAUAUAUUGGUGGUUUAUUUGAAGGAGAUGGUUGAAUUACUAUUUCAAAAAAAGGUAAAUAUUUAUUAUAUGAAUUAGGUAUUGAAAUACAUAUUAGAGAUAUUCAAUUAUUAUAUAAAAUUAAAAAUAUUUUAGGUAUUGGUAAAGUAACAAUUAAAAAAUUAAAAAUAAAAGAUGGUACUAUUAAAGAAAUAUGUAAAUUUAAUGUAAGAAAUAAAAAUCAUUUAAAGAAUAUUAUUAUUCCUAUUUUUGAUAAAUAUCCUAUAUUAACUAAUAAACAUUAUGAUUAUUUAUAUUUUAAAGAUAAUUUAUUAAAAGAUAUUAAAUAUUAUAAUGAUUUAUCUUAUUAUUUACGUCCUAUUAAACCAUUUAAUACUCUUGAAGAUAUUUUAAAUAAAAAUUAUUUUUCUUCAUGAUUAAUUGGUUUUUUUGAAGCUGAAAGUUGUUUUAGUAUUUAUAAACCUAUAAAUAAAAAAAUAAAACUUGCUAGUUUUGAAGUAUCUCAAAAUAAUAGUAUAGAAGUUAUAUUAGCUAUUAAAUCAUAUUUAAAAAUUACUCAAAAUAUUUAUACAGAUAAAUUUAAUAAUUCAAGAAUAACACUUAAAAGUAUUAAUGGUAUUAAAAAUGUUGUAAUAUUUAUUAAUAAUAACCCUAUUAAAUUAUUAGGUUAUAAAAAAUUACAAUAUUUAUUAUUCUUAAAAGAUUUACGUCUUAUUCUUAAAUAUAAUAAUUAUUUUAAAAUUCCUCCUAAAUAUUAAUCUUAUAUAAAAAUAUAAUAAUAAUAUAUUUAUAUAUUAUAUAAUUAUAUAAACAAAAUAUAAUUUAUAUAUAAUUAUUUAUUAUAAAUAUAGUCCGGCCCGCCCCGCGGGGCGGACCCCGGAGGAGUGAGGGACCCCUCCCUAUUCUAACGGGAGGGGGACCGAACCCCGAAGGAGUUUAAUUAUAUAUUAAAUAUAUUAUUAUCAAUAAAUAAUUCCUUUGAACUAUUUAUUAUUUUAUUAUAUUUAUUUUCUCCUUCAUUAUUAAUUUUUAUUAAUAAUUAAAAUCUUAUCAUUUUAUGGUAUUUUUAUUUCUAUUUUAGGAUAUCGAAACUAUAAAUUAAAAAGUAUAAUUUUAUUAAUUAUAAUUUAUGAUUAAUAAAUAAGAAAUAAAAACUUUAGAAGUAAUAUUUAUCUUUUUUUUUUAUAAAUAAAUAUUAUGAUUAAUAUAUAAUCAUUUAUAAAUAUUUAUAUAUAAUUAUAUAUAUACAUAAAUAGGAUUAAGAUAUAGUCCGAACAAUAUAGUGAUAUAUUGAUAAUAGUUUUCAAAUAUGUAACUAUUUAAACAUUAAAAG gmp GMP 5'-GMP GMP Guanosine 5'-monophosphate Guanosine 5'-phosphate Guanosine monophosphate guanosine-5'-monophosphate Guanylic acid pG 5'-guanylic acid [(2R,3S,4R,5R)-5-(2-amino-6-oxo-1,6-dihydro-9H-purin-9-yl)-3,4-dihydroxytetrahydrofuran-2-yl]methyl dihydrogen phosphate small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) RQFCJASXJCIDSX-UUOKFMHZSA-N RQFCJASXJCIDSX-UUOKFMHZSA-N mrs1_yeast Mitochondrial RNA-splicing protein MRS1 YIR021W MRS1 PET157 protein protein yeast Saccharomyces cerevisiae Baker's yeast MSPKNITRSVIPAIDLYCRKANFKTLKSLSMILGSKKEWYDTKKAPLRTFLVSRCGIFEQLRGRLVEDGKVNLFSVFLTNDSFSFCKMTVDDKFNTSLVDWQKIPFDSTFATDRRQNISLLPVDTLFATEKIISILGVSPNMTNLVSIERERSDLVDFNCKLQSNILEHLLYAKCQGVYVTSTNEKARLLAAVCNPEFIDTFWCELTPIRVSLKENPSISVPREYQMYDPVVRATIKEVVTKRLLRSAFDNDIDPLMCLHLDKGWKLKFPILSSTTGLNFSLKDCLSLDTGKDASDMTEVFLATMESSKVLRTYSNLVDIVMKDNGRLDSGVLKQFNDYVKQEKLNLQHFQAGSSKFLKGAKI 6270FCD7EBF8267E bi3-bi3_intron_yeast_mrna-1 1 6 cofactor cofactor coenzyme unspecified role unspecified role 7 unspecified role unspecified role neutral component neutral component n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 4 unspecified role unspecified role unspecified role unspecified role ecoli Escherichia coli (strain K12) 5 enzyme target enzyme target substrate substrate neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined rna cleavage rna cleavage Fig. 2A, 2B, 3A An intron in which a 1,325-nucleotide loop in L8 is deleted is sufficient to bind The Km of the binding of GMP to the bI3 ribonucleoprotein ternary complex was measured as 180uM bi3-bi3_intron_yeast_mrna-2 3 4 unspecified role unspecified role bait bait ecoli Escherichia coli (strain K12) 5 unspecified role unspecified role prey prey region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined direct interaction direct interaction Fig. 3B, 3C Interaction observed in presence of magnesium. bi3_intron_yeast_mrna-mrs1-1 3 7 unspecified role unspecified role prey prey n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 5 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined direct interaction direct interaction Fig. 3D MRS1 dimer binding to the bI3 intron is strongly cooperative under optimal splicing conditions (20 mM Mg2+). In the absence of Mg2+, binding is noncooperative. bi3-bi3_intron_yeast_mrna-4 2 7 unspecified role unspecified role neutral component neutral component n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 4 unspecified role unspecified role neutral component neutral component ecoli Escherichia coli (strain K12) 5 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association Fig. 4B, Table 1 An intron in which a 1,325-nucleotide loop in L8 is deleted is sufficient to bind Mol wt=420kDa bi3_intron_yeast_mrna-mrs1-2 2 7 unspecified role unspecified role neutral component neutral component n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 5 unspecified role unspecified role neutral component neutral component bi3_intronic_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined direct interaction direct interaction Table 1 An intron in which a 1,325-nucleotide loop in L8 is deleted is sufficient to bind Mol wt=372kDa mrs1-1 2 7 unspecified role unspecified role neutral component neutral component n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Table 1 An intron in which a 1,325-nucleotide loop in L8 is deleted is sufficient to bind Mol wt=92kDa bi3-bi3_intron_yeast_mrna-5 2 4 unspecified role unspecified role neutral component neutral component ecoli Escherichia coli (strain K12) 5 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association Table 1 An intron in which a 1,325-nucleotide loop in L8 is deleted is sufficient to bind Mol wt=220kDa bi3_intron_yeast_mrna-mrs1-3 3 7 unspecified role unspecified role prey prey n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 5 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined direct interaction direct interaction Fig. 3E Stoichiometric binding assay