IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ The active site of yeast aspartyl-tRNA synthetase: structural and functional aspects of the aminoacylation reaction The active site of yeast aspartyl-tRNA synthetase: structural and functional aspects of the aminoacylation reaction The EMBO Journal 1994 imex curation Cavarelli J 18-Apr-2017: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro x-ray diffraction x-ray crystallography X-ray X-ray x-ray diffraction predetermined predetermined participant predetermined Cavarelli J Accepted 2017-MAR-15 AT 12:23 GMT AT 12:23 GMT by MGT The EMBO Journal 1994 imex curation Thanks! I have corrected accordingly and added a comment at the interaction level about mutagenesis The active site of yeast aspartyl-tRNA synthetase: structural and functional aspects of the aminoacylation reaction The active site of yeast aspartyl-tRNA synthetase: structural and functional aspects of the aminoacylation reaction The EMBO Journal 1994 imex curation Cavarelli J 18-Apr-2017: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro enzymatic study enzymatic study tag visualisation tag visualisation Cavarelli J I have only started to annotate mutations in table 3. I am not sure if I correctly interpret their results. I have considered asp Km and Kd but sometimes they look contradictory to me (see asp471ala or glu478asp). Suggestions are welcome! The reaction mix was filtered on 0.22 micrometers pore size nitrocellulose, then dried and counted Accepted 2017-MAR-15 AT 12:23 GMT AT 12:23 GMT by MGT The EMBO Journal 1994 imex curation Thanks! I have corrected accordingly and added a comment at the interaction level about mutagenesis trna_asp_guc tRna Asp GUC trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast UCCGUGAUAGUUUAAUGGUCAGAAUGGGCGCUUGUCGCGUGCCAGAUCGGGGUUCAAUUCCCCGUCGCGGAG sydc_yeast Aspartate--tRNA ligase, cytoplasmic DPS1 APS APS1 Aspartyl-tRNA synthetase L1295 YLL018C protein protein yeast Saccharomyces cerevisiae Baker's yeast MSQDENIVKAVEESAEPAQVILGEDGKPLSKKALKKLQKEQEKQRKKEERALQLEAEREAREKKAAAEDTAKDNYGKLPLIQSRDSDRTGQKRVKFVDLDEAKDSDKEVLFRARVHNTRQQGATLAFLTLRQQASLIQGLVKANKEGTISKNMVKWAGSLNLESIVLVRGIVKKVDEPIKSATVQNLEIHITKIYTISETPEALPILLEDASRSEAEAEAAGLPVVNLDTRLDYRVIDLRTVTNQAIFRIQAGVCELFREYLATKKFTEVHTPKLLGAPSEGGSSVFEVTYFKGKAYLAQSPQFNKQQLIVADFERVYEIGPVFRAENSNTHRHMTEFTGLDMEMAFEEHYHEVLDTLSELFVFIFSELPKRFAHEIELVRKQYPVEEFKLPKDGKMVRLTYKEGIEMLRAAGKEIGDFEDLSTENEKFLGKLVRDKYDTDFYILDKFPLEIRPFYTMPDPANPKYSNSYDFFMRGEEILSGAQRIHDHALLQERMKAHGLSPEDPGLKDYCDGFSYGCPPHAGGGIGLERVVMFYLDLKNIRRASLFPRDPKRLRP 6656279B3E9011A5 6656279B3E9011A5 aspartic acid aspartic acid (+-)-Aspartic acid (R,S)-Aspartic acid 2-aminobutanedioic acid Asp Aspartic acid D DL-Aminosuccinic acid DL-Asparagic acid aspartic acid small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) atp ATP Adenosine 5'-triphosphate Adenosine triphosphate ADENOSINE-5'-TRIPHOSPHATE Adephos Adetol Adynol Atipi ATP Atriphos Cardenosine Fosfobion Glucobasin H4atp Myotriphos Triadenyl Triphosphaden adenosine 5'-(tetrahydrogen triphosphate) small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) trna asp-1 1 3 unspecified role unspecified role neutral component neutral component in vitro In vitro 4 unspecified role unspecified role neutral component neutral component ecoli Escherichia coli (strain K12) direct interaction direct interaction Table 1 0.225 2.7 dps1-trna_asp_guc-1 1 5 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 3 unspecified role unspecified role neutral component neutral component in vitro In vitro 4 unspecified role unspecified role neutral component neutral component ecoli Escherichia coli (strain K12) 6 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction Table 1 0.212 3.0 trna asp-2 2 3 enzyme target enzyme target substrate substrate neutral component neutral component label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro 4 enzyme enzyme neutral component neutral component P04802:p.Gln303Asn mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain Q N Wed May 02 17:00:48 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'gln303asn' Tue Jun 30 18:57:27 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gln303Asn' P04802:p.His334Arg mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain H R Wed May 02 15:21:26 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'his334arg' Tue Jun 30 16:57:49 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.His334Arg' P04802:p.Ser329Ala mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain S A Wed May 02 17:10:35 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'ser329ala' Tue Jun 30 16:01:36 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ser329Ala' P04802:p.His334Lys mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain H K Wed May 02 17:52:13 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'his334lys' Tue Jun 30 18:22:03 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.His334Lys' ecoli Escherichia coli (strain K12) 5 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction Table 3 Authors classify residues potentially relevant for the reaction in 3 groups and identify by extensive mutagenesis analysis the essential ones, listed below: Group 1, residues that contact ATP: Arg325, Asp471, Glu478 Group 2, residues that contact amino acid: Gln303, Asp342, Arg485, Glu344, Lys306 Group 3, residues that contact tRNA: Ser301 Glu327, His334 However, individually all these residues contribute only weakly to the tRNA-enzyme binding energy, with little changes in Kd dps1-trna_asp_guc-2 1 3 unspecified role unspecified role neutral component neutral component in vitro In vitro 4 unspecified role unspecified role neutral component neutral component ecoli Escherichia coli (strain K12) 6 unspecified role unspecified role neutral component neutral component in vitro In vitro direct interaction direct interaction Table 1 0.203 3