IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Spliceosomal RNA U6 is remarkably conserved from yeast to mammals. Spliceosomal RNA U6 is remarkably conserved from yeast to mammals. Nature 1988 imex curation Brow DA., Guthrie C. Samples were incubated at increasing temperatures before migration to evaluate the melting temperature of the complex 22-Jun-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation yeast Saccharomyces cerevisiae Baker's yeast comig non denat gel comigration in non denaturing gel electrophoresis comig non denat gel northern blot northern blot northen Brow DA., Guthrie C. Samples were incubated at increasing temperatures before migration to evaluate the melting temperature of the complex Accepted 2016-MAY-09 AT 11:46 BST AT 11:46 BST by MGT Nature 1988 imex curation snr14_u4_yeast SNR14 snrna small nuclear rna snRNA snrna yeast Saccharomyces cerevisiae Baker's yeast AUCCUUAUGCACGGGAAAUACGCAUAUCAGUGAGGAUUCGUCCGAGAUUGUGUUUUUGCUGGUUGAAAUUUAAUUAUAAACCAGACCGUCUCCUCAUGGUCAAUUCGGUGUUCGCUUUUGAAUACUUCAAGACUAUGUAGGGAAUUUUUGGAAUACCUUU snru6_yeast small nuclear RNA U6 Yeast snrna small nuclear rna snRNA snrna yeast Saccharomyces cerevisiae Baker's yeast GUUCGCGAAGUAACCCUUCGUGGACAUUUGGUCAAUUUGAAACAAUACAGAGAUGAUCAGCAGUUCCCCUGCAUAAGGAUGAACCGUUUUACAAAGAGAUUUAUUUCGUUUU u4/u6-1 1 3 unspecified role unspecified role neutral component neutral component 2 unspecified role unspecified role neutral component neutral component physical association physical association Fig 4