IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ A domain of the actin binding protein Abp140 is the yeast methyltransferase responsible for 3-methylcytidine modification in the tRNA anti-codon loop. A domain of the actin binding protein Abp140 is the yeast methyltransferase responsible for 3-methylcytidine modification in the tRNA anti-codon loop. RNA (New York, N.Y.) 2011 imex curation D'Silva S., Haider SJ., Phizicky EM. eric_phizicky@urmc.rochester.edu 17-Oct-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro methyltransferase as methyltransferase assay methyltransferase as primer extension assay primer extension assay primer extension assay D'Silva S., Haider SJ., Phizicky EM. eric_phizicky@urmc.rochester.edu Accepted 2016-SEP-22 AT 11:06 BST AT 11:06 BST by ORCHARD RNA (New York, N.Y.) 2011 imex curation A domain of the actin binding protein Abp140 is the yeast methyltransferase responsible for 3-methylcytidine modification in the tRNA anti-codon loop. A domain of the actin binding protein Abp140 is the yeast methyltransferase responsible for 3-methylcytidine modification in the tRNA anti-codon loop. RNA (New York, N.Y.) 2011 imex curation D'Silva S., Haider SJ., Phizicky EM. eric_phizicky@urmc.rochester.edu 17-Oct-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro methyltransferase as methyltransferase assay methyltransferase as weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra D'Silva S., Haider SJ., Phizicky EM. eric_phizicky@urmc.rochester.edu Accepted 2016-SEP-22 AT 11:06 BST AT 11:06 BST by ORCHARD RNA (New York, N.Y.) 2011 imex curation trna thr agu (igu) tRNA Thr AGU (IGU) trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GCUUCUAUGGCCAAGUUGGUAAGGCGCCACACUAGUAAUGUGGAGAUCAUCGGUUCAAAUCCGAUUGGAAGCA ab140_yeast tRNA(Thr) (cytosine(32)-N(3))-methyltransferase ABP140 Actin-binding protein of 140 kDa TRM140 tRNA methyltransferase of 140 kDa YOR240W YOR239W protein protein yeast Saccharomyces cerevisiae Baker's yeast MGVADLIKKFESISKEEGDATVDTNSSSKPLKSNDETKELHQQESTAVPQEVDVNEEFENEPETINSSRTAEKPLETNLPKPETNEEDEEEGSMSENKIYSKGENADINVNDFQEYKEMENTGAEVLASSVEESDAIQEGVAEETEGIATPKQKENEKNDESEEESANNASEPAEEYSQSEEDADIEQSNGKETENAENASQQANDGSTSTTTSKNKKKKNKKKNKKKRNGNVNTNANVDDSTKTGENDDTTGDTTSSTTSAIQEVNDLEVVDDSCLGIDQQHNREHLKALTQDVKEETLENIAHEGRGDNTGDQNAVEKSDFEKSDTEGSRIGRDLPFEFGKRNLTEESDVWDHNAWDNVEWGEEQVQQAEEKIKEQFKHPVPEFDKKLYNENPARYWDIFYKNNKENFFKDRKWLQIEFPILYASTRKDAEPVTIFEIGCGAGNTFFPILKDNENENLRIIAADFAPRAVELVKNSEQFNPKYGHATVWDLANPDGNLPDGVEPHSVDIAVMIFVFSALAPNQWDQAMDNLHKILKPGGKIIFRDYGAYDLTQVRFKKNRILEENFYVRGDGTRVYFFSEEKLREIFTKKYFLENKIGTDRRLLVNRKRQLKMYRCWVQAVFDVPQ 74F9CA30BC5BCABF trm140 trna the-1 2 3 enzyme target enzyme target substrate substrate neutral component neutral component label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined methylation rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain C32A mutation disrupting rate mutation disrupting interaction rate mutation disrupting rate certain certain sequence position certain certain certain sequence position certain C A in vitro In vitro 4 enzyme enzyme neutral component neutral component 3C His6 HA ZZ tandem tag tandem tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) methylation methylation reaction methylation Fg 3 B, Fig 4A, Suppl Fig 3 abp140-trna thr agu (igu)-1 2 3 enzyme target enzyme target substrate substrate neutral component neutral component label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined methylation rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain in vitro In vitro 4 enzyme enzyme neutral component neutral component His6 3C tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) methylation methylation reaction methylation Fg 3 B abp140-trna thr agu (igu)-2 1 3 enzyme target enzyme target substrate substrate neutral component neutral component methylation rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain yeast Saccharomyces cerevisiae Baker's yeast 4 enzyme enzyme neutral component neutral component 3C His6 HA ZZ tandem tag tandem tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range yeast Saccharomyces cerevisiae Baker's yeast methylation methylation reaction methylation Fig 4B