IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Identification of yeast tRNA Um(44) 2'-O-methyltransferase (Trm44) and demonstration of a Trm44 role in sustaining levels of specific tRNA(Ser) species. Identification of yeast tRNA Um(44) 2'-O-methyltransferase (Trm44) and demonstration of a Trm44 role in sustaining levels of specific tRNA(Ser) species. RNA (New York, N.Y.) 2008 imex curation Kotelawala L., Grayhack EJ., Phizicky EM. eric_phizicky@urmc.rochester.edu 17-Oct-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro methyltransferase as methyltransferase assay methyltransferase as weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Kotelawala L., Grayhack EJ., Phizicky EM. The presence of a methyl mod on U44 creates a bond resistant to RNAse digestion. tRNA ser was specifically labeled at 3' of U44 so that the digestion of Um44 yield the dinucleotide UmG, while the unmodified U44 yield inorganic P eric_phizicky@urmc.rochester.edu Accepted 2016-SEP-29 AT 09:58 BST AT 09:58 BST by MGT RNA (New York, N.Y.) 2008 imex curation trna ser uga trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GGCACUAUGGCCGAGUGGUUAAGGCGACAGACUUGAAAUCUGUUGGGCUCUGCCCGCGCUGGUUCAAAUCCUGCUGGUGUCG trm44_yeast tRNA (uracil-O(2)-)-methyltransferase TRM44 tRNA(Ser) (uridine(44)-2'-O)-methyltransferase YPL030W protein protein yeast Saccharomyces cerevisiae Baker's yeast MTGDGSAHISKNNQNQHKDRFKFIVNDKSILGPQWLSLYQTDGKVTFAKSHFEQAMMNVIREPNINSTVILRADILKEINHAAEAGSEPKFDESVLKKFEIDNGNESGEEDVKKINIEDLNIRSCETSESLKLSPVHEFVRRIIPRNFYKDAIINQTCLILNSKDPNFQETSLIVYTPHINSEKDCPFYIPRTQSVGILLHQSVLSVHYIPFPEDKTAFTDESERVVRTAYRLLQTANKHSKGVMQGYEKRVNHDQVVNKVNFQNTYIVLKKKYSKFLVENWAESTDPKKHVFEDIAIAAFLIELWIKVYGPDFRSKMQFRDLGCGNGALCYILLSESIKGLGIDARKRKSWSIYPPEVQSSLKEQVIIPSILLRPHPALKRQVPHLEHNGRFFPVKVTHEVIAPATVVYSSEDLLKSPQVNTAEFPPDTFIIGNHSDELTCWIPLLGHPYMVIPCCSHNFSGQRVRFNVRKRSPRSNEIKNQNNSKSTYSGLVDHVEYISSRVGWKVEKEMLRIPSTRNAAIIGVENATLKHFPTQAVYDMIWEDGGAEGWIQNTMSLLKRNPRNH 5374D45014C047C0 trm44-trna ser uga-1 1 3 enzyme enzyme neutral component neutral component tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range yeast Saccharomyces cerevisiae Baker's yeast 2 enzyme target enzyme target substrate substrate neutral component neutral component label 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain U methylation rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain in vitro In vitro methylation methylation reaction methylation Fig 1 D trm44-trna ser uga-2 1 3 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 2 enzyme target enzyme target substrate substrate neutral component neutral component label 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain U methylation rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain in vitro In vitro methylation methylation reaction methylation Fig 2 C