IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Multisite-specific tRNA:m5C-methyltransferase (Trm4) in yeast Saccharomyces cerevisiae: identification of the gene and substrate specificity of the enzyme. Multisite-specific tRNA:m5C-methyltransferase (Trm4) in yeast Saccharomyces cerevisiae: identification of the gene and substrate specificity of the enzyme. RNA (New York, N.Y.) 1999 imex curation Motorin Y., Grosjean H. Yuri.Motorin@lebs.cnrs-gif.fr 20-Dec-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro methyltransferase as methyltransferase assay methyltransferase as autoradiography autoradiography Motorin Y., Grosjean H. Identification was performed by the “nearest-neighbor” analysis: Depending on the nature of the nucleotide adjacent to the cytosine to be modified the RNA transcripts were radiolabeled with either [a-32P]GTP or [a-32P]UTP+ the RNA was extracted and completely hydrolyzed to nucleoside monophosphates by RNAse T2. Each hydrolysate was chromatographed on two-dimensional tlc plates and the radio-activity in the spots was evaluated after exposure to a PhosphorImager screen current identifiers for mini phe/leu and asp tRNAs have been used, sequences differ slightly from those given in Fig 4 Yuri.Motorin@lebs.cnrs-gif.fr Accepted 2016-OCT-20 AT 10:58 BST AT 10:58 BST by MGT RNA (New York, N.Y.) 1999 imex curation Yes there is no seq like fig 4H for leu. I have used URS00001346E7 because it contains the intron, has a different 5' but region 27-77 is identical to fig 4H except for the anticodon. Now in manually curated databases I can' t find ant yeast tRNAleu with CUA as a codon, so I choose this one. I added a statement at experiment level. Mature Phe is identical to fig 4 while Asp has minor differences; Figure 7 A+B contains 4 plus 3 reactions, that I added. As far as I understood it is related to fig 6 not 5 (see the text p1110). I added the statement about sequences Multisite-specific tRNA:m5C-methyltransferase (Trm4) in yeast Saccharomyces cerevisiae: identification of the gene and substrate specificity of the enzyme. Multisite-specific tRNA:m5C-methyltransferase (Trm4) in yeast Saccharomyces cerevisiae: identification of the gene and substrate specificity of the enzyme. RNA (New York, N.Y.) 1999 imex curation Motorin Y., Grosjean H. Yuri.Motorin@lebs.cnrs-gif.fr 20-Dec-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro methyltransferase as methyltransferase assay methyltransferase as tag visualisation tag visualisation Motorin Y., Grosjean H. current identifiers for mini phe/leu and asp tRNAs have been used, sequences differ slightly from those given in Fig 4 Yuri.Motorin@lebs.cnrs-gif.fr Accepted 2016-OCT-20 AT 10:58 BST AT 10:58 BST by MGT RNA (New York, N.Y.) 1999 imex curation Yes there is no seq like fig 4H for leu. I have used URS00001346E7 because it contains the intron, has a different 5' but region 27-77 is identical to fig 4H except for the anticodon. Now in manually curated databases I can' t find ant yeast tRNAleu with CUA as a codon, so I choose this one. I added a statement at experiment level. Mature Phe is identical to fig 4 while Asp has minor differences; Figure 7 A+B contains 4 plus 3 reactions, that I added. As far as I understood it is related to fig 6 not 5 (see the text p1110). I added the statement about sequences trna_asp_guc tRna Asp GUC trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast UCCGUGAUAGUUUAAUGGUCAGAAUGGGCGCUUGUCGCGUGCCAGAUCGGGGUUCAAUUCCCCGUCGCGGAG trna ile uau trna ile uau trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GCUCGUGUAGCUCAGUGGUUAGAGCUUCGUGCUUAUAACGCGACCGUCGUGGGUUCAAACCCCACCUCGAGCA ncl1_yeast Multisite-specific tRNA:(cytosine-C(5))-methyltransferase NCL1 YBL024W YBL0437 TRM4 tRNA methyltransferase 4 Multisite-specific tRNA:m5C-methyltransferase tRNA (cytosine-5-)-methyltransferase NCL1 protein protein yeast Saccharomyces cerevisiae Baker's yeast MARRKNFKKGNKKTFGARDDSRAQKNWSELVKENEKWEKYYKTLALFPEDQWEEFKKTCQAPLPLTFRITGSRKHAGEVLNLFKERHLPNLTNVEFEGEKIKAPVELPWYPDHLAWQLDVPKTVIRKNEQFAKTQRFLVVENAVGNISRQEAVSMIPPIVLEVKPHHTVLDMCAAPGSKTAQLIEALHKDTDEPSGFVVANDADARRSHMLVHQLKRLNSANLMVVNHDAQFFPRIRLHGNSNNKNDVLKFDRILCDVPCSGDGTMRKNVNVWKDWNTQAGLGLHAVQLNILNRGLHLLKNNGRLVYSTCSLNPIENEAVVAEALRKWGDKIRLVNCDDKLPGLIRSKGVSKWPVYDRNLTEKTKGDEGTLDSFFSPSEEEASKFNLQNCMRVYPHQQNTGGFFITVFEKVEDSTEAATEKLSSETPALESEGPQTKKIKVEEVQKKERLPRDANEEPFVFVDPQHEALKVCWDFYGIDNIFDRNTCLVRNATGEPTRVVYTVCPALKDVIQANDDRLKIIYSGVKLFVSQRSDIECSWRIQSESLPIMKHHMKSNRIVEANLEMLKHLLIESFPNFDDIRSKNIDNDFVEKMTKLSSGCAFIDVSRNDPAKENLFLPVWKGNKCINLMVCKEDTHELLYRIFGIDANAKATPSAEEKEKEKETTESPAETTTGTSTEAPSAAN 92FA9177CF4AB2CF 92FA9177CF4AB2CF trna leu caa precursor tRNA Leu CAA precursor trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GGUUGUUUGGCCGAGCGGUCUAAGGCGCCUGAUUCAAGAAAUAUCUUGACCGCAGUGAACUGUGGGAAUACUCAGGUAUCGUAAGAUGCAAGAGUUCGAAUCUCUUAGCAACCA trna ser aga trna ser AGA trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GGCAACUUGGCCGAGUGGUUAAGGCGAAAGAUUAGAAAUCUUUUGGGCUUUGGCCCGCGCAGGUUCGAGUCCUGCAGUUGUCG trna phe gaa precursor trna Phe GAA precursor trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GCGGACUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAAAAACUUCGGUCAAGUCAUCUGGAGGUCCUGUGUUCGAUCCACAGAGUUCGCA trna phe gaa trna Phe GAA trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA trna_tyr _gua tRNATyr GUA trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast CUCUCGGUAGCCAAGUUGGUUUAAGGCGCAAGACUGUAAAUCUUGAGAUCGGGCGUUCGACUCGCCCCCGGGAGA ncl1-trna_asp_guc-1 2 5 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 3 enzyme target enzyme target substrate substrate neutral component neutral component methylation rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain in vitro In vitro methylation methylation reaction methylation Fig 5 ncl1-trna phe gaa-1 2 9 enzyme target enzyme target substrate substrate neutral component neutral component methylation rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain in vitro In vitro 5 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) methylation methylation reaction methylation Fig 5 ncl1-trna phe gaa precursor-1 2 8 enzyme target enzyme target substrate substrate neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain methylation rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain in vitro In vitro 5 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) methylation methylation reaction methylation Fig 5 ncl1-trna leu caa precursor-1 2 6 enzyme target enzyme target substrate substrate neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain methylation rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain in vitro In vitro 5 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) methylation methylation reaction methylation Fig 5 ncl1-trna phe gaa-2 1 9 enzyme target enzyme target substrate substrate neutral component neutral component methylation rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain UTP label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro 5 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) methylation methylation reaction methylation Fig 6, Fig 7 ncl1-trna tyr-1 1 10 enzyme target enzyme target substrate substrate neutral component neutral component GTP label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined methylation rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain in vitro In vitro 5 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) methylation methylation reaction methylation Fig 6, Fig 7 ncl1-trna phe gaa precursor-2 1 8 enzyme target enzyme target substrate substrate neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain methylation rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain UTP label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro 5 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) methylation methylation reaction methylation Fig 6, Fig 7 ncl1-trna leu caa precursor-2 1 6 enzyme target enzyme target substrate substrate neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain methylation rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain UTP label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro 5 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) methylation methylation reaction methylation Fig 6, Fig 7 ncl1-trna_asp_guc-2 1 5 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 3 enzyme target enzyme target substrate substrate neutral component neutral component methylation rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro methylation methylation reaction methylation Fig 7 ncl1-trna ile-1 1 4 enzyme target enzyme target substrate substrate neutral component neutral component methylation rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro 5 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) methylation methylation reaction methylation Fig 6, Fig 7 ncl1- trna ser-1 1 7 enzyme target enzyme target substrate substrate neutral component neutral component methylation rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro 5 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) methylation methylation reaction methylation Fig 6, Fig 7