IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Involvement of multiple elements in FXR-mediated transcriptional activation of FGF19. Involvement of multiple elements in FXR-mediated transcriptional activation of FGF19. The Journal of steroid biochemistry and molecular biology 2012 imex curation Miyata M., Hata T., Yamakawa H., Kagawa T., Yoshinari K., Yamazoe Y., Miyata M., Hata T., Yamakawa H., Kagawa T., Yoshinari K., Yamazoe Y. IBD - Inflammatory bowel disease miyata@m.tohoku.ac.jp 21-Mar-2017: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Miyata M., Hata T., Yamakawa H., Kagawa T., Yoshinari K., Yamazoe Y., Miyata M., Hata T., Yamakawa H., Kagawa T., Yoshinari K., Yamazoe Y. IBD - Inflammatory bowel disease miyata@m.tohoku.ac.jp Accepted 2017-JAN-26 AT 16:39 GMT AT 16:39 GMT by PPORRAS The Journal of steroid biochemistry and molecular biology 2012 Only protein-protein interactions imex curation imex curation Involvement of multiple elements in FXR-mediated transcriptional activation of FGF19. Involvement of multiple elements in FXR-mediated transcriptional activation of FGF19. The Journal of steroid biochemistry and molecular biology 2012 imex curation Miyata M., Hata T., Yamakawa H., Kagawa T., Yoshinari K., Yamazoe Y., Miyata M., Hata T., Yamakawa H., Kagawa T., Yoshinari K., Yamazoe Y. IBD - Inflammatory bowel disease miyata@m.tohoku.ac.jp 21-Mar-2017: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa autoradiography autoradiography Miyata M., Hata T., Yamakawa H., Kagawa T., Yoshinari K., Yamazoe Y., Miyata M., Hata T., Yamakawa H., Kagawa T., Yoshinari K., Yamazoe Y. IBD - Inflammatory bowel disease miyata@m.tohoku.ac.jp Accepted 2017-JAN-26 AT 16:39 GMT AT 16:39 GMT by PPORRAS The Journal of steroid biochemistry and molecular biology 2012 Only protein-protein interactions imex curation imex curation Involvement of multiple elements in FXR-mediated transcriptional activation of FGF19. Involvement of multiple elements in FXR-mediated transcriptional activation of FGF19. The Journal of steroid biochemistry and molecular biology 2012 imex curation Miyata M., Hata T., Yamakawa H., Kagawa T., Yoshinari K., Yamazoe Y., Miyata M., Hata T., Yamakawa H., Kagawa T., Yoshinari K., Yamazoe Y. IBD - Inflammatory bowel disease miyata@m.tohoku.ac.jp 21-Mar-2017: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-ls147t Homo sapiens ls147t Human colon adenocarcinoma LS147T cells ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Miyata M., Hata T., Yamakawa H., Kagawa T., Yoshinari K., Yamazoe Y., Miyata M., Hata T., Yamakawa H., Kagawa T., Yoshinari K., Yamazoe Y. IBD - Inflammatory bowel disease miyata@m.tohoku.ac.jp Accepted 2017-JAN-26 AT 16:39 GMT AT 16:39 GMT by PPORRAS The Journal of steroid biochemistry and molecular biology 2012 Only protein-protein interactions imex curation imex curation p4_probe_fgf19_promoter ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human GGCCTGGGCGGGGTCACCCCGGCTGGGACAAGAAGCCGCC ir1_probe_fgf19 promoter ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human CCTGCAGTTCAGTGACCTTTGCA p2_probe_fgf19_promoter ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human GGTTTGGGTCGTGTCCCCCAGTGCAGCCTCTGCCATCGCCCTCAAGAGCATTTATC fgf19_human_gene Fibroblast growth factor 19 FGF19 gene gene human Homo sapiens Human nr1h4_human Bile acid receptor NR1H4 BAR FXR HRR1 RIP14 Farnesoid X-activated receptor Farnesol receptor HRR-1 Nuclear receptor subfamily 1 group H member 4 Retinoid X receptor-interacting protein 14 protein protein human Homo sapiens Human MVMQFQGLENPIQISPHCSCTPSGFFMEMMSMKPAKGVLTEQVAGPLGQNLEVEPYSQYSNVQFPQVQPQISSSSYYSNLGFYPQQPEEWYSPGIYELRRMPAETLYQGETEVAEMPVTKKPRMGASAGRIKGDELCVVCGDRASGYHYNALTCEGCKGFFRRSITKNAVYKCKNGGNCVMDMYMRRKCQECRLRKCKEMGMLAECMYTGLLTEIQCKSKRLRKNVKQHADQTVNEDSEGRDLRQVTSTTKSCREKTELTPDQQTLLHFIMDSYNKQRMPQEITNKILKEEFSAEENFLILTEMATNHVQVLVEFTKKLPGFQTLDHEDQIALLKGSAVEAMFLRSAEIFNKKLPSGHSDLLEERIRNSGISDEYITPMFSFYKSIGELKMTQEEYALLTAIVILSPDRQYIKDREAVEKLQEPLLDVLQKLCKIHQPENPQHFACLLGRLTELRTFNHHHAEMLMSWRVNDHKFTPLLCEIWDVQ C23283576A8CF76B p1_probe_fgf19 promoter ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human GAGAGGGCAATGGGTCAGCGGTCCACGACCTACCCAGGGAGTGGCCGGGTG rxra_human Retinoic acid receptor RXR-alpha RXRA NR2B1 Retinoid X receptor alpha Nuclear receptor subfamily 2 group B member 1 protein protein human Homo sapiens Human MDTKHFLPLDFSTQVNSSLTSPTGRGSMAAPSLHPSLGPGIGSPGQLHSPISTLSSPINGMGPPFSVISSPMGPHSMSVPTTPTLGFSTGSPQLSSPMNPVSSSEDIKPPLGLNGVLKVPAHPSGNMASFTKHICAICGDRSSGKHYGVYSCEGCKGFFKRTVRKDLTYTCRDNKDCLIDKRQRNRCQYCRYQKCLAMGMKREAVQEERQRGKDRNENEVESTSSANEDMPVERILEAELAVEPKTETYVEANMGLNPSSPNDPVTNICQAADKQLFTLVEWAKRIPHFSELPLDDQVILLRAGWNELLIASFSHRSIAVKDGILLATGLHVHRNSAHSAGVGAIFDRVLTELVSKMRDMQMDKTELGCLRAIVLFNPDSKGLSNPAEVEALREKVYASLEAYCKHKYPEQPGRFAKLLLRLPALRSIGLKCLEHLFFFKLIGDTPIDTFLMEMLEAPHQMT DIP protein P19793 original sequence version: 177 DIP protein P19793 original sequence version: 107 DIP protein P19793 original sequence version: 153 DIP protein P19793 original sequence version: 131 DIP protein P19793 original sequence version: 136 DIP protein P19793 original sequence version: 169 DIP protein P19793 original sequence version: 161 DIP protein P19793 original sequence version: 139 7F952B580AD84C42 p1_probe_fgf19 promoter-nr1h4-1 2 10 unspecified role unspecified role prey prey in vitro In vitro 8 unspecified role unspecified role prey prey in vitro In vitro 9 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined C30A,G27T mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain C T certain certain sequence position certain certain certain sequence position certain G A chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association 2B, Supp 2A Two retarded bands were seen using Probe P1 in the presence of both FXR and RXRa, but no band in the presence of each individual protein with the probe. p1_probe_fgf19 promoter-nr1h4-2 1 10 unspecified role unspecified role prey prey in vitro In vitro 8 unspecified role unspecified role prey prey in vitro In vitro 9 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association 2B p1_probe_fgf19 promoter-nr1h4-3 2 9 competitor competitor competitor prey prey chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role prey prey in vitro In vitro 8 unspecified role unspecified role prey prey in vitro In vitro 9 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association 2B, supp 2A C30A,G27T mutation on P1 competitor probe inhibits its competitor role, increasing the amount of labelled probe bound. p1_probe_fgf19 promoter-nr1h4-4 2 5 competitor competitor competitor prey prey chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role prey prey in vitro In vitro 8 unspecified role unspecified role prey prey in vitro In vitro 9 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association 2Bii ir1_probe_fgf19 promoter-nr1h4-1 2 10 unspecified role unspecified role prey prey in vitro In vitro 8 unspecified role unspecified role prey prey in vitro In vitro 5 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association 2B, 2C, 2D ir1_probe_fgf19 promoter-nr1h4-2 1 10 unspecified role unspecified role prey prey in vitro In vitro 8 unspecified role unspecified role prey prey in vitro In vitro 5 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association 2B, 2C, 2D p2_probe_fgf19_promoter-nr1h4-1 2 10 unspecified role unspecified role prey prey in vitro In vitro 8 unspecified role unspecified role prey prey in vitro In vitro 6 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association 2C Two retarded bands were seen using Probe P2 in the presence of both FXR and RXRa, but no band in the presence of each individual protein with the probe. p2_probe_fgf19_promoter-nr1h4-2 1 10 unspecified role unspecified role prey prey in vitro In vitro 8 unspecified role unspecified role prey prey in vitro In vitro 6 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association 2C p4_probe_fgf19_promoter-nr1h4-1 2 10 unspecified role unspecified role prey prey in vitro In vitro 8 unspecified role unspecified role prey prey in vitro In vitro 4 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined G12T,C15A mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain G T certain certain sequence position certain certain certain sequence position certain C A chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association 2D, Supp 2C p4_probe_fgf19_promoter-nr1h4-2 1 10 unspecified role unspecified role prey prey in vitro In vitro 8 unspecified role unspecified role prey prey in vitro In vitro 4 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association 2D nr1h4-fgf19-2 3 7 unspecified role unspecified role prey prey P2 and P4 promoter regions sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 8 unspecified role unspecified role bait bait association association 3 P19793 and CHEBI:16755 increases expression at RNA level of ENSG00000162344 P19793 and CHEBI:79997 increases expression at RNA level of ENSG00000162344 I do not see any instances of GW4064 nor CDCA increasing levels of transcription of FGF19 unless FXR is present. p2_probe_fgf19_promoter-nr1h4-3 2 10 unspecified role unspecified role prey prey in vitro In vitro 8 unspecified role unspecified role prey prey in vitro In vitro 6 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 5 competitor competitor competitor prey prey chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Supp 2B p2_probe_fgf19_promoter-ir1_probe_fgf19 promoter-1 2 10 unspecified role unspecified role prey prey in vitro In vitro 8 unspecified role unspecified role prey prey in vitro In vitro 6 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 6 competitor competitor competitor prey prey chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Supp 2Bi p4_probe_fgf19_promoter-ir1_probe_fgf19 promoter-1 2 5 competitor competitor competitor prey prey chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role prey prey in vitro In vitro 8 unspecified role unspecified role prey prey in vitro In vitro 4 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Supp 2C p4_probe_fgf19_promoter-nr1h4-3 2 4 competitor competitor competitor prey prey chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role prey prey in vitro In vitro 8 unspecified role unspecified role prey prey in vitro In vitro 4 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Supp 2Ci G12T,C15A mutation on P4 competitor probe completely abrogates its competitor role, increasing the amount of labelled probe bound.