IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ CREB/ATF-dependent T cell receptor-induced FoxP3 gene expression: a role for DNA methylation. CREB/ATF-dependent T cell receptor-induced FoxP3 gene expression: a role for DNA methylation. The Journal of experimental medicine 2007 imex curation Kim HP., Leonard WJ., Kim HP., Leonard WJ. IBD - Inflammatory bowel disease wjl@helix.nih.gov 21-10-2015: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro affinity techniques affinity technology affinity techniques western blot western blot Immuno blot Immuno blot Kim HP., Leonard WJ., Kim HP., Leonard WJ. IBD - Inflammatory bowel disease According to pmid:8896456 (from Ref 16 ) a radioactive probe was used. Nuclear extracts were from human Kit225 cells stimulated with PMA + ionomycin. wjl@helix.nih.gov Accepted 2015-OCT-14 AT 09:32 BST AT 09:32 BST by ORCHARD The Journal of experimental medicine 2007 Only protein-protein interactions imex curation imex curation CREB/ATF-dependent T cell receptor-induced FoxP3 gene expression: a role for DNA methylation. CREB/ATF-dependent T cell receptor-induced FoxP3 gene expression: a role for DNA methylation. The Journal of experimental medicine 2007 imex curation Kim HP., Leonard WJ., Kim HP., Leonard WJ. IBD - Inflammatory bowel disease wjl@helix.nih.gov 21-10-2015: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Kim HP., Leonard WJ., Kim HP., Leonard WJ. IBD - Inflammatory bowel disease According to pmid:8896456 (from Ref 16 ) a radioactive probe was used. nuclear extracts from anti-CD3/anti-CD28–activated mouse CD4+ splenic T cells. wjl@helix.nih.gov Accepted 2015-OCT-14 AT 09:32 BST AT 09:32 BST by ORCHARD The Journal of experimental medicine 2007 Only protein-protein interactions imex curation imex curation CREB/ATF-dependent T cell receptor-induced FoxP3 gene expression: a role for DNA methylation. CREB/ATF-dependent T cell receptor-induced FoxP3 gene expression: a role for DNA methylation. The Journal of experimental medicine 2007 imex curation Kim HP., Leonard WJ., Kim HP., Leonard WJ. IBD - Inflammatory bowel disease wjl@helix.nih.gov 21-10-2015: Contacted by IntAct-Help. Only protein-protein interactions imex curation mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Kim HP., Leonard WJ., Kim HP., Leonard WJ. IBD - Inflammatory bowel disease The antibody used against the target CREB is not stated for ChIP; it has been assumed the same antibody/target (supplier -millipore) was used as for EMSA experiments. I have added the pcr probe 5-prime sequence to the Feature CD4+CD25- cells from male mice; stimulated with anti-CD3/28/IL2 in the presence or absence of TGF-beta. wjl@helix.nih.gov Accepted 2015-OCT-14 AT 09:32 BST AT 09:32 BST by ORCHARD The Journal of experimental medicine 2007 Only protein-protein interactions imex curation imex curation CREB/ATF-dependent T cell receptor-induced FoxP3 gene expression: a role for DNA methylation. CREB/ATF-dependent T cell receptor-induced FoxP3 gene expression: a role for DNA methylation. The Journal of experimental medicine 2007 imex curation Kim HP., Leonard WJ., Kim HP., Leonard WJ. IBD - Inflammatory bowel disease wjl@helix.nih.gov 21-10-2015: Contacted by IntAct-Help. Only protein-protein interactions imex curation mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Kim HP., Leonard WJ., Kim HP., Leonard WJ. IBD - Inflammatory bowel disease The antibody used against the target CREB is not stated for ChIP; it has been assumed the same antibody/target (supplier -millipore) was used as for EMSA experiments. I have added the pcr probe 5-prime sequence to the Feature (island) CD4+CD25+ T reg cells. wjl@helix.nih.gov Accepted 2015-OCT-14 AT 09:32 BST AT 09:32 BST by ORCHARD The Journal of experimental medicine 2007 Only protein-protein interactions imex curation imex curation CREB/ATF-dependent T cell receptor-induced FoxP3 gene expression: a role for DNA methylation. CREB/ATF-dependent T cell receptor-induced FoxP3 gene expression: a role for DNA methylation. The Journal of experimental medicine 2007 imex curation Kim HP., Leonard WJ., Kim HP., Leonard WJ. IBD - Inflammatory bowel disease wjl@helix.nih.gov 21-10-2015: Contacted by IntAct-Help. Only protein-protein interactions imex curation mouse-ctll_2 Mus musculus CTLL-2 C57b1/6 T cell lymphoblasts ctll_2 CTLL-2 mouse C57b1/6 T cell lymphoblasts ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Kim HP., Leonard WJ., Kim HP., Leonard WJ. IBD - Inflammatory bowel disease I have added the pcr probe 5-prime sequence to the Features wjl@helix.nih.gov Accepted 2015-OCT-14 AT 09:32 BST AT 09:32 BST by ORCHARD The Journal of experimental medicine 2007 Only protein-protein interactions imex curation imex curation creb1_human Cyclic AMP-responsive element-binding protein 1 CREB1 protein protein human Homo sapiens Human MTMESGAENQQSGDAAVTEAENQQMTVQAQPQIATLAQVSMPAAHATSSAPTVTLVQLPNGQTVQVHGVIQAAQPSVIQSPQVQTVQISTIAESEDSQESVDSVTDSQKRREILSRRPSYRKILNDLSSDAPGVPRIEEEKSEEETSAPAITTVTVPTPIYQTSSGQYIAITQGGAIQLANNGTDGVQGLQTLTMTNAAATQPGTTILQYAQTTDGQQILVPSNQVVVQAASGDVQTYQIRTAPTSTIAPGVVMASSPALPTQPAEEAARKREVRLMKNREAARECRRKKKEYVKCLENRVAVLENQNKTLIEELKALKDLYCHKSD DIP protein P16220 original sequence version: 169 DIP protein P16220 original sequence version: 158 F5BA8200EE5184B7 mecp2_mouse Methyl-CpG-binding protein 2 Mecp2 protein protein mouse Mus musculus Mouse MVAGMLGLREEKSEDQDLQGLRDKPLKFKKAKKDKKEDKEGKHEPLQPSAHHSAEPAEAGKAETSESSGSAPAVPEASASPKQRRSIIRDRGPMYDDPTLPEGWTRKLKQRKSGRSAGKYDVYLINPQGKAFRSKVELIAYFEKVGDTSLDPNDFDFTVTGRGSPSRREQKPPKKPKSPKAPGTGRGRGRPKGSGTGRPKAAASEGVQVKRVLEKSPGKLVVKMPFQASPGGKGEGGGATTSAQVMVIKRPGRKRKAEADPQAIPKKRGRKPGSVVAAAAAEAKKKAVKESSIRSVHETVLPIKKRKTRETVSIEVKEVVKPLLVSTLGEKSGKGLKTCKSPGRKSKESSPKGRSSSASSPPKKEHHHHHHHSESTKAPMPLLPSPPPPEPESSEDPISPPEPQDLSSSICKEEKMPRGGSLESDGCPKEPAKTQPMVATTTTVAEKYKHRGEGERKDIVSSSMPRPNREEPVDSRTPVTERVS DIP protein Q9Z2D6 original sequence version: 154 62FD228F0118A49F foxp3_mouse_gene Forkhead box protein P3 Foxp3 gene gene mouse Mus musculus Mouse atf2_human Cyclic AMP-dependent transcription factor ATF-2 ATF2 CREB2 CREBP1 Activating transcription factor 2 cAMP response element-binding protein CRE-BP1 HB16 Cyclic AMP-responsive element-binding protein 2 protein protein human Homo sapiens Human MKFKLHVNSARQYKDLWNMSDDKPFLCTAPGCGQRFTNEDHLAVHKHKHEMTLKFGPARNDSVIVADQTPTPTRFLKNCEEVGLFNELASPFENEFKKASEDDIKKMPLDLSPLATPIIRSKIEEPSVVETTHQDSPLPHPESTTSDEKEVPLAQTAQPTSAIVRPASLQVPNVLLTSSDSSVIIQQAVPSPTSSTVITQAPSSNRPIVPVPGPFPLLLHLPNGQTMPVAIPASITSSNVHVPAAVPLVRPVTMVPSVPGIPGPSSPQPVQSEAKMRLKAALTQQHPPVTNGDTVKGHGSGLVRTQSEESRPQSLQQPATSTTETPASPAHTTPQTQSTSGRRRRAANEDPDEKRRKFLERNRAAASRCRQKRKVWVQSLEKKAEDLSSLNGQLQSEVTLLRNEVAQLKQLLLAHKDCPVTAMQKKSGYHTADKDDSSEDISVPSSPHTEAIQHSSVSTSNGVSSTSKAEAVATSVLTQMADQSTEPALSQIVMAPSSQSQPSGS 0190EEFAEC8891A7 atf1_human Cyclic AMP-dependent transcription factor ATF-1 Activating transcription factor 1 Protein TREB36 ATF1 protein protein human Homo sapiens Human MEDSHKSTTSETAPQPGSAVQGAHISHIAQQVSSLSESEESQDSSDSIGSSQKAHGILARRPSYRKILKDLSSEDTRGRKGDGENSGVSAAVTSMSVPTPIYQTSSGQYIAIAPNGALQLASPGTDGVQGLQTLTMTNSGSTQQGTTILQYAQTSDGQQILVPSNQVVVQTASGDMQTYQIRTTPSATSLPQTVVMTSPVTLTSQTTKTDDPQLKREIRLMKNREAARECRRKKKEYVKCLENRVAVLENQNKTLIEELKTLKDLYSNKSV DIP protein P18846 original sequence version: 120 BAFECBFFB244FCED dnmt1_mouse DNA (cytosine-5)-methyltransferase 1 Dnmt1 Dnmt Met1 Uim MCMT DNA methyltransferase MmuI protein protein mouse Mus musculus Mouse MPARTAPARVPALASPAGSLPDHVRRRLKDLERDGLTEKECVREKLNLLHEFLQTEIKSQLCDLETKLHKEELSEEGYLAKVKSLLNKDLSLENGTHTLTQKANGCPANGSRPTWRAEMADSNRSPRSRPKPRGPRRSKSDSDTLSVETSPSSVATRRTTRQTTITAHFTKGPTKRKPKEESEEGNSAESAAEERDQDKKRRVVDTESGAAAAVEKLEEVTAGTQLGPEEPCEQEDDNRSLRRHTRELSLRRKSKEDPDREARPETHLDEDEDGKKDKRSSRPRSQPRDPAAKRRPKEAEPEQVAPETPEDRDEDEREEKRRKTTRKKLESHTVPVQSRSERKAAQSKSVIPKINSPKCPECGQHLDDPNLKYQQHPEDAVDEPQMLTSEKLSIYDSTSTWFDTYEDSPMHRFTSFSVYCSRGHLCPVDTGLIEKNVELYFSGCAKAIHDENPSMEGGINGKNLGPINQWWLSGFDGGEKVLIGFSTAFAEYILMEPSKEYEPIFGLMQEKIYISKIVVEFLQNNPDAVYEDLINKIETTVPPSTINVNRFTEDSLLRHAQFVVSQVESYDEAKDDDETPIFLSPCMRALIHLAGVSLGQRRATRRVMGATKEKDKAPTKATTTKLVYQIFDTFFSEQIEKYDKEDKENAMKRRRCGVCEVCQQPECGKCKACKDMVKFGGTGRSKQACLKRRCPNLAVKEADDDEEADDDVSEMPSPKKLHQGKKKKQNKDRISWLGQPMKIEENRTYYQKVSIDEEMLEVGDCVSVIPDDSSKPLYLARVTALWEDKNGQMMFHAHWFCAGTDTVLGATSDPLELFLVGECENMQLSYIHSKVKVIYKAPSENWAMEGGTDPETTLPGAEDGKTYFFQLWYNQEYARFESPPKTQPTEDNKHKFCLSCIRLAELRQKEMPKVLEQIEEVDGRVYCSSITKNGVVYRLGDSVYLPPEAFTFNIKVASPVKRPKKDPVNETLYPEHYRKYSDYIKGSNLDAPEPYRIGRIKEIHCGKKKGKVNEADIKLRLYKFYRPENTHRSYNGSYHTDINMLYWSDEEAVVNFSDVQGRCTVEYGEDLLESIQDYSQGGPDRFYFLEAYNSKTKNFEDPPNHARSPGNKGKGKGKGKGKGKHQVSEPKEPEAAIKLPKLRTLDVFSGCGGLSEGFHQAGISETLWAIEMWDPAAQAFRLNNPGTTVFTEDCNVLLKLVMAGEVTNSLGQRLPQKGDVEMLCGGPPCQGFSGMNRFNSRTYSKFKNSLVVSFLSYCDYYRPRFFLLENVRNFVSYRRSMVLKLTLRCLVRMGYQCTFGVLQAGQYGVAQTRRRAIILAAAPGEKLPLFPEPLHVFAPRACQLSVVVDDKKFVSNITRLSSGPFRTITVRDTMSDLPEIQNGASNSEIPYNGEPLSWFQRQLRGSHYQPILRDHICKDMSPLVAARMRHIPLFPGSDWRDLPNIQVRLGDGVIAHKLQYTFHDVKNGYSSTGALRGVCSCAEGKACDPESRQFSTLIPWCLPHTGNRHNHWAGLYGRLEWDGFFSTTVTNPEPMGKQGRVLHPEQHRVVSVRECARSQGFPDSYRFFGNILDRHRQVGNAVPPPLAKAIGLEIKLCLLSSARESASAAVKAKEEAATKD 4F9A98CEAF09F037 tyy1_mouse Transcriptional repressor protein YY1 Yy1 Ucrbp Delta transcription factor NF-E1 UCR-motif DNA-binding protein Yin and yang 1 protein protein mouse Mus musculus Mouse MASGDTLYIATDGSEMPAEIVELHEIEVETIPVETIETTVVGEEEEEDDDDEDGGGGDHGGGGGGHGHAGHHHHHHHHHHHHPPMIALQPLVTDDPTQVHHHQEVILVQTREEVVGGDDSDGLRAEDGFEDQILIPVPAPAGGDDDYIEQTLVTVAAAGKSGGGASSGGGRVKKGGGKKSGKKSYLGGGAGAAGGGGADPGNKKWEQKQVQIKTLEGEFSVTMWSSDEKKDIDHETVVEEQIIGENSPPDYSEYMTGKKLPPGGIPGIDLSDPKQLAEFARMKPRKIKEDDAPRTIACPHKGCTKMFRDNSAMRKHLHTHGPRVHVCAECGKAFVESSKLKRHQLVHTGEKPFQCTFEGCGKRFSLDFNLRTHVRIHTGDRPYVCPFDGCNKKFAQSTNLKSHILTHAKAKNNQ DIP protein Q00899 original sequence version: 121 DIP protein Q00899 original sequence version: 107 DIP protein Q00899 original sequence version: 112 C012378288E984F9 creb1_mouse Cyclic AMP-responsive element-binding protein 1 Creb1 Creb-1 protein protein mouse Mus musculus Mouse MTMESGADNQQSGDAAVTEAENQQMTVQAQPQIATLAQVSMPAAHATSSAPTVTLVQLPNGQTVQVHGVIQAAQPSVIQSPQVQTVQISTIAESEDSQESVDSVTDSQKRREILSRRPSYRKILNDLSSDAPGVPRIEEEKSEEETSAPAITTVTVPTPIYQTSSGQYIAITQGGAIQLANNGTDGVQGLQTLTMTNAAATQPGTTILQYAQTTDGQQILVPSNQVVVQAASGDVQTYQIRTAPTSTIAPGVVMASSPALPTQPAEEAARKREVRLMKNREAARECRRKKKEYVKCLENRVAVLENQNKTLIEELKALKDLYCHKSD 00D1F26B00D48442 wt_foxp3_intron1_yy1/creb_site_cns3_region_probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid mouse Mus musculus Mouse CCGGCCGCCATGACGTCAATGGCAGAA wt_foxp3_intron1_yy1/creb_site_cns3_region_probe-creb1-1 2 14 unspecified role unspecified role bait bait region radiolabelled radiolabel radiolabeled radiolabelled undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 13 unspecified role unspecified role prey prey possible_phospho_res phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined observed-ptm observed-ptm observed ptm observed-ptm mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes physical association physical association 1D complex II was supershifted wt_foxp3_intron1_yy1/creb_site_cns3_region_probe-creb1-2 1 9 unspecified role unspecified role prey prey human-kit 225 Homo sapiens kit 225 kit 225 14 unspecified role unspecified role bait bait A13T mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain A T chemical synthesis Chemical synthesis (Chemical synthesis) 6 unspecified role unspecified role prey prey possible_phospho_res phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined observed-ptm observed-ptm observed ptm observed-ptm human-kit 225 Homo sapiens kit 225 kit 225 10 unspecified role unspecified role prey prey human-kit 225 Homo sapiens kit 225 kit 225 physical association physical association 1E creb1-foxp3-1 4 8 unspecified role unspecified role prey prey CNS3_intronic_CpG_island sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 13 unspecified role unspecified role bait bait possible_phospho_res phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association 5B Binding was only seen to the CpG island in CD4+CD25+ T reg cells; no binding was seen in CD4+CD25- cells, and no binding to the promoter region in both cell types. dnmt1-foxp3-1 5 8 unspecified role unspecified role prey prey CNS3_intronic_CpG_island sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 11 unspecified role unspecified role bait bait association association 5C CHEBI:2038 -5-azacytidine - a cytosine nucleoside analogue that inhibits DNA methyltransferase;it can also be used in vitro to remove methyl groups from DNA CHEBI:2038 decreases the binding of P13864 to ENSMUSG00000039521 CHEBI:2038 increases the expression at protein level of ENSMUSG00000039521 CHEBI:2038 decreases the methylation of ENSMUSG00000039521 P13864 decreases the expression at RNA level of ENSMUSG00000039521 P13864 decreases the expression at protein level of ENSMUSG00000039521 causality from Supp Fig 9, 3,4 dnmt1-foxp3-2 5 8 unspecified role unspecified role prey prey CNS3_intronic_CpG_island sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 7 unspecified role unspecified role bait bait association association 5Ci CHEBI:2038 -5-azacytidine - a cytosine nucleoside analogue that inhibits DNA methyltransferase;it can also be used in vitro to remove methyl groups from DNA CHEBI:2038 decreases the binding of Q9Z2D6 to ENSMUSG00000039521 creb1-foxp3-2 3 8 unspecified role unspecified role prey prey CNS3_intronic_CpG_island sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 13 unspecified role unspecified role bait bait possible_phospho_res phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association 5D TGF-beta creb1-foxp3-3 3 8 unspecified role unspecified role prey prey CNS3_intronic_CpG_island sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 11 unspecified role unspecified role bait bait association association 5Di TGF-beta wt_foxp3_intron1_yy1/creb_site_cns3_region_probe-yy1-1 2 14 unspecified role unspecified role bait bait region radiolabelled radiolabel radiolabeled radiolabelled undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 12 unspecified role unspecified role prey prey mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes physical association physical association Supp 4 complex I was supershifted