IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Rep provides a second motor at the replisome to promote duplication of protein-bound DNA. Rep provides a second motor at the replisome to promote duplication of protein-bound DNA. Mol. Cell (1097-2765) 2009 imex curation Guy C.P., Atkinson J., Gupta M.K., Mahdi A.A., Gwynn E.J., Rudolph C.J., Moon P.B., van Knippenberg I.C., Cadman C.J., Dillingham M.S., Lloyd R.G., McGlynn P. p.mcglynn@abdn.ac.uk 16-Apr-2013: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa autoradiography autoradiography Guy C.P., Atkinson J., Gupta M.K., Mahdi A.A., Gwynn E.J., Rudolph C.J., Moon P.B., van Knippenberg I.C., Cadman C.J., Dillingham M.S., Lloyd R.G., McGlynn P. p.mcglynn@abdn.ac.uk Accepted 2013-APR-04 by ORCHARD 16-Apr-2013: Contacted by IntAct-Help. Mol. Cell (1097-2765) 2009 Only protein-protein interactions imex curation Rep provides a second motor at the replisome to promote duplication of protein-bound DNA. Rep provides a second motor at the replisome to promote duplication of protein-bound DNA. Mol. Cell (1097-2765) 2009 imex curation Guy C.P., Atkinson J., Gupta M.K., Mahdi A.A., Gwynn E.J., Rudolph C.J., Moon P.B., van Knippenberg I.C., Cadman C.J., Dillingham M.S., Lloyd R.G., McGlynn P. p.mcglynn@abdn.ac.uk 16-Apr-2013: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro spr surface plasmon resonance Optical biosensor BIAcore(r) BIAcore(r) Optical biosensor spr predetermined predetermined participant predetermined Guy C.P., Atkinson J., Gupta M.K., Mahdi A.A., Gwynn E.J., Rudolph C.J., Moon P.B., van Knippenberg I.C., Cadman C.J., Dillingham M.S., Lloyd R.G., McGlynn P. p.mcglynn@abdn.ac.uk Accepted 2013-APR-04 by ORCHARD 16-Apr-2013: Contacted by IntAct-Help. Mol. Cell (1097-2765) 2009 Only protein-protein interactions imex curation Rep provides a second motor at the replisome to promote duplication of protein-bound DNA. Rep provides a second motor at the replisome to promote duplication of protein-bound DNA. Mol. Cell (1097-2765) 2009 imex curation Guy C.P., Atkinson J., Gupta M.K., Mahdi A.A., Gwynn E.J., Rudolph C.J., Moon P.B., van Knippenberg I.C., Cadman C.J., Dillingham M.S., Lloyd R.G., McGlynn P. p.mcglynn@abdn.ac.uk 16-Apr-2013: Contacted by IntAct-Help. Only protein-protein interactions ecoli Escherichia coli (strain K12) anti tag coip anti tag coimmunoprecipitation anti tag coip western blot western blot Immuno blot Immuno blot Guy C.P., Atkinson J., Gupta M.K., Mahdi A.A., Gwynn E.J., Rudolph C.J., Moon P.B., van Knippenberg I.C., Cadman C.J., Dillingham M.S., Lloyd R.G., McGlynn P. p.mcglynn@abdn.ac.uk Accepted 2013-APR-04 by ORCHARD 16-Apr-2013: Contacted by IntAct-Help. Mol. Cell (1097-2765) 2009 Only protein-protein interactions imex curation q9x4c9_geose Replicative DNA helicase dnaB protein protein geose Geobacillus stearothermophilus Geobacillus stearothermophilus Bacillus stearothermophilus MSELFSERIPPQSIEAEQAVLGAVFLDPAALVPASEILIPEDFYRAAHQKIFHAMLRVADRGEPVDLVTVTAELAASEQLEEIGGVSYLSELADAVPTAANVEYYARIVEEKSVLRRLIRTATSIAQDGYTREDEIDVLLDEADRKIMEVSQRKHSGAFKNIKDILVQTYDNIEMLHNRDGEITGIPTGFTELDRMTSGFQRSDLIIVAARPSVGKTAFALNIAQNVATKTNENVAIFSLEMSAQQLVMRMLCAEGNINAQNLRTGKLTPEDWGKLTMAMGSLSNAGIYIDDTPSIRVSDIRAKCRRLKQESGLGMIVIDYLQLIQGSGRSKENRQQEVSEISRSLKALARELEVPVIALSQLSRSVEQRQDKRPMMSDIRESGSIEQDADIVAFLYRDDYYNKDSENKNIIEIIIAKQRNGPVGTVQLAFIKEYNKFVNLERRFDEAQIPPGA DIP protein Q9X4C9 original sequence version: 62 D6115B868E11BAC0 dnab_ecoli Replicative DNA helicase dnaB groP grpA b4052 JW4012 protein protein ecoli Escherichia coli (strain K12) MAGNKPFNKQQAEPRERDPQVAGLKVPPHSIEAEQSVLGGLMLDNERWDDVAERVVADDFYTRPHRHIFTEMARLQESGSPIDLITLAESLERQGQLDSVGGFAYLAELSKNTPSAANISAYADIVRERAVVREMISVANEIAEAGFDPQGRTSEDLLDLAESRVFKIAESRANKDEGPKNIADVLDATVARIEQLFQQPHDGVTGVNTGYDDLNKKTAGLQPSDLIIVAARPSMGKTTFAMNLVENAAMLQDKPVLIFSLEMPSEQIMMRSLASLSRVDQTKIRTGQLDDEDWARISGTMGILLEKRNIYIDDSSGLTPTEVRSRARRIAREHGGIGLIMIDYLQLMRVPALSDNRTLEIAEISRSLKALAKELNVPVVALSQLNRSLEQRADKRPVNSDLRESGSIEQDADLIMFIYRDEVYHENSDLKGIAEIIIGKQRNGPIGTVRLTFNGQWSRFDNYAGPQYDDE 5B5ED3625A7F7DE5 forked dna reverse forked dna reverse ds dna double stranded deoxyribonucleic acid ds DNA ds dna chemical synthesis Chemical synthesis (Chemical synthesis) GCAAGCCTTCTACAGGTCGACCGTCCATGGCGACTCGAGACCGCAATACGGATAAGGGCTGAGCACGCCGACGAACATTCACCACGCCAGACCACGTA forked dna forward forked dna forward ds dna double stranded deoxyribonucleic acid ds DNA ds dna chemical synthesis Chemical synthesis (Chemical synthesis) GACTATCTACGTCCGAGGCTCGCGCCGCAGACTCATTTAGCCCTTATCCGTATTGCGGTCTCGAGTCGCCATGGACGGTCGACCTGTAGAAGGCTTGC rep_ecoli ATP-dependent DNA helicase Rep rep b3778 JW5604 protein protein ecoli Escherichia coli (strain K12) MRLNPGQQQAVEFVTGPCLVLAGAGSGKTRVITNKIAHLIRGCGYQARHIAAVTFTNKAAREMKERVGQTLGRKEARGLMISTFHTLGLDIIKREYAALGMKANFSLFDDTDQLALLKELTEGLIEDDKVLLQQLISTISNWKNDLKTPSQAAASAIGERDRIFAHCYGLYDAHLKACNVLDFDDLILLPTLLLQRNEEVRKRWQNKIRYLLVDEYQDTNTSQYELVKLLVGSRARFTVVGDDDQSIYSWRGARPQNLVLLSQDFPALKVIKLEQNYRSSGRILKAANILIANNPHVFEKRLFSELGYGAELKVLSANNEEHEAERVTGELIAHHFVNKTQYKDYAILYRGNHQSRVFEKFLMQNRIPYKISGGTSFFSRPEIKDLLAYLRVLTNPDDDSAFLRIVNTPKREIGPATLKKLGEWAMTRNKSMFTASFDMGLSQTLSGRGYEALTRFTHWLAEIQRLAEREPIAAVRDLIHGMDYESWLYETSPSPKAAEMRMKNVNQLFSWMTEMLEGSELDEPMTLTQVVTRFTLRDMMERGESEEELDQVQLMTLHASKGLEFPYVYMVGMEEGFLPHQSSIDEDNIDEERRLAYVGITRAQKELTFTLCKERRQYGELVRPEPSRFLLELPQDDLIWEQERKVVSAEERMQKGQSHLANLKAMMAAKRGK 3338B3399C668E3E rep-dnab-3 1 5 unspecified role unspecified role prey prey ecoli Escherichia coli (strain K12) 8 unspecified role unspecified role prey prey n-terminal biotin tag biotin tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 6 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 1-98 binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 7 unspecified role unspecified role bait bait 1-98 binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 15 17 physical association physical association Fig. 6c rep-dnab-2 3 8 unspecified role unspecified role bait bait n-terminal biotin tag biotin tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range 641-673 required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 5 unspecified role unspecified role prey prey ecoli Escherichia coli (strain K12) direct interaction direct interaction Fig. 6b dnab-rep-1 2 8 unspecified role unspecified role prey prey n-terminal biotin tag biotin tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 5 unspecified role unspecified role bait bait ecoli Escherichia coli (strain K12) direct interaction direct interaction Fig. 6a dnab-rep-geose 2 8 unspecified role unspecified role prey prey n-terminal biotin tag biotin tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 4 unspecified role unspecified role bait bait geose Geobacillus stearothermophilus Geobacillus stearothermophilus Bacillus stearothermophilus direct interaction direct interaction Fig. 6a rep-dnab-1 2 8 unspecified role unspecified role bait bait n-terminal biotin tag biotin tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range 641-673 required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 5 unspecified role unspecified role prey prey ecoli Escherichia coli (strain K12) direct interaction direct interaction Fig.s 6i, S3, S4, S5