NTNU NTNU, Norwegian University of Science and Technology www.ntnu.no/home Paired-like homeoprotein ESXR1 acts as a sequence-specific transcriptional repressor of the human K-ras gene. Paired-like homeoprotein ESXR1 acts as a sequence-specific transcriptional repressor of the human K-ras gene. Oncogene (0950-9232) 2005 imex curation Yanagihara M., Ishikawa S., Naito M., Nakajima J., Aburatani H., Hatakeyama M. human origin of homeoprotein EZXR1 was ascertained by checking the reference Ozawa H et al, 2004, PMID:15235584 (given in the paper as source for EZXR1) mhata@igm.hokudai.ac.jp 11-Jun-2014: Contacted by IntAct-Help. in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa autoradiography autoradiography Yanagihara M., Ishikawa S., Naito M., Nakajima J., Aburatani H., Hatakeyama M. human origin of homeoprotein EZXR1 was ascertained by checking the reference Ozawa H et al, 2004, PMID:15235584 (given in the paper as source for EZXR1) mhata@igm.hokudai.ac.jp Accepted 2014-MAY-27 by ORCHARD Oncogene (0950-9232) 2005 imex curation Paired-like homeoprotein ESXR1 acts as a sequence-specific transcriptional repressor of the human K-ras gene. Paired-like homeoprotein ESXR1 acts as a sequence-specific transcriptional repressor of the human K-ras gene. Oncogene (0950-9232) 2005 imex curation Yanagihara M., Ishikawa S., Naito M., Nakajima J., Aburatani H., Hatakeyama M. human origin of homeoprotein EZXR1 was ascertained by checking the reference Ozawa H et al, 2004, PMID:15235584 (given in the paper as source for EZXR1) mhata@igm.hokudai.ac.jp 11-Jun-2014: Contacted by IntAct-Help. in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Yanagihara M., Ishikawa S., Naito M., Nakajima J., Aburatani H., Hatakeyama M. human origin of homeoprotein EZXR1 was ascertained by checking the reference Ozawa H et al, 2004, PMID:15235584 (given in the paper as source for EZXR1) mhata@igm.hokudai.ac.jp Accepted 2014-MAY-27 by ORCHARD Oncogene (0950-9232) 2005 imex curation Paired-like homeoprotein ESXR1 acts as a sequence-specific transcriptional repressor of the human K-ras gene. Paired-like homeoprotein ESXR1 acts as a sequence-specific transcriptional repressor of the human K-ras gene. Oncogene (0950-9232) 2005 imex curation Yanagihara M., Ishikawa S., Naito M., Nakajima J., Aburatani H., Hatakeyama M. human origin of homeoprotein EZXR1 was ascertained by checking the reference Ozawa H et al, 2004, PMID:15235584 (given in the paper as source for EZXR1) mhata@igm.hokudai.ac.jp 11-Jun-2014: Contacted by IntAct-Help. human-u2-os Human U2-OS osteosarcoma cell line u2-os U2-OS osteocaroma cell line Not in CAPRI and no primary literature reference ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Yanagihara M., Ishikawa S., Naito M., Nakajima J., Aburatani H., Hatakeyama M. human origin of homeoprotein EZXR1 was ascertained by checking the reference Ozawa H et al, 2004, PMID:15235584 (given in the paper as source for EZXR1) mhata@igm.hokudai.ac.jp Accepted 2014-MAY-27 by ORCHARD Oncogene (0950-9232) 2005 imex curation kras_human_gene Kirsten rat sarcoma viral oncogene homolog gene gene human Homo sapiens Human esx1_human Homeobox protein ESX1 ESX1 ESX1L ESX1R Extraembryonic, spermatogenesis, homeobox 1 protein protein human Homo sapiens Human MESLRGYTHSDIGYRSLAVGEDIEEVNDEKLTVTSLMARGGEDEENTRSKPEYGTEAENNVGTEGSVPSDDQDREGGGGHEPEQQQEEPPLTKPEQQQEEPPLLELKQEQEEPPQTTVEGPQPAEGPQTAEGPQPPERKRRRRTAFTQFQLQELENFFDESQYPDVVARERLAARLNLTEDRVQVWFQNRRAKWKRNQRVLMLRNTATADLAHPLDMFLGGAYYAAPALDPALCVHLVPQLPRPPVLPVPPMPPRPPMVPMPPRPPIAPMPPMAPVPPGSRMAPVPPGPRMAPVPPWPPMAPVPPWPPMAPVPTGPPMAPVPPGPPMARVPPGPPMARVPPGPPMAPLPPGPPMAPLPPGPPMAPLPPGPPMAPLPPRSHVPHTGLAPVHITWAPVINSYYACPFF 7013E3986F1148FA kras_human_dna_51bp_intronic K-ras intronic regulatory region, 51bp fragment dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) TAAAAGGGTAAAGGACATCTTAATGTTATTATGAAAACAGTTTTGACCTCT esx1-kras 3 K-ras 4 unspecified role unspecified role prey prey esxr1 5 unspecified role unspecified role bait bait region sufficient for dna binding and transcription regulation sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain mutation is deletion of C-terminus containing a repeat region and leaving the N-terminal amino acids 1-229 encompassing e.g. the homeodomain intact (cloning of deletion mutant described in PMID:15235584) region myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined human-u2-os Human U2-OS osteosarcoma cell line u2-os U2-OS osteocaroma cell line Not in CAPRI and no primary literature reference association association Fig 4d Q8N693 decreases expression at RNA level of ENSG00000133703 Q8N693 decreases expression at RNA level of ENSG00000133703 (decreases activity of intronic regulatory region (SO:0001492) as measured in reporter gene assay). Reported in Figure 4b kras-esx1-2 1 6 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 6 competitor competitor competitor prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain a23c_t29g_t30g_a31c mutation mutation certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 5 unspecified role unspecified role prey prey region sufficient for dna binding and transcription regulation sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chlae-cos_7 Cercopithecus aethiops simian cells transformed with SV40 Grivet cos_7 cercopithecus aethiops, by transformation with SV40 physical association physical association Fig 4c kras-esx1-1 2 6 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 5 unspecified role unspecified role prey prey region sufficient for dna binding and transcription regulation sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain mutation is deletion of C-terminus containing a repeat region and leaving the N-terminal amino acids 1-229 encompassing e.g. the homeodomain intact (cloning of deletion mutant described in PMID:15235584) chlae-cos_7 Cercopithecus aethiops simian cells transformed with SV40 Grivet cos_7 cercopithecus aethiops, by transformation with SV40 physical association physical association Fig 4c kras-esx1-1 1 6 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 5 unspecified role unspecified role prey prey region sufficient for dna binding and transcription regulation sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain mutation is deletion of C-terminus containing a repeat region and leaving the N-terminal amino acids 1-229 encompassing e.g. the homeodomain intact (cloning of deletion mutant described in PMID:15235584) chlae-cos_7 Cercopithecus aethiops simian cells transformed with SV40 Grivet cos_7 cercopithecus aethiops, by transformation with SV40 physical association physical association Fig 4c